Mutagenetix > Incidental Mutation

Incidental Mutation 'R6763:Nup133'

531782

Institutional Source

Beutler Lab

Gene Symbol

Nup133

Ensembl Gene

ENSMUSG00000039509

Gene Name

nucleoporin 133

Synonyms

mermaid, 4832420O05Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6763 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

123897123-123949265 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 123944278 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 127 (I127V)

Ref Sequence

ENSEMBL: ENSMUSP00000048084 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044795] [ENSMUST00000127664]

AlphaFold

Q8R0G9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044795
AA Change: I127V

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000048084
Gene: ENSMUSG00000039509
AA Change: I127V

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
PDB:1XKS\|A	66	513	N/A	PDB
Pfam:Nucleoporin_C	593	1052	1.2e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear envelope creates distinct nuclear and cytoplasmic compartments in eukaryotic cells. It consists of two concentric membranes perforated by nuclear pores, large protein complexes that form aqueous channels to regulate the flow of macromolecules between the nucleus and the cytoplasm. These complexes are composed of at least 100 different polypeptide subunits, many of which belong to the nucleoporin family. The nucleoporin protein encoded by this gene displays evolutionarily conserved interactions with other nucleoporins. This protein, which localizes to both sides of the nuclear pore complex at interphase, remains associated with the complex during mitosis and is targeted at early stages to the reforming nuclear envelope. This protein also localizes to kinetochores of mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality prior to E10.5, abnormal somitogenesis, pericardial edema, growth retardation, and abnormal neural development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaas	C	A	15: 102,340,022	R286L	probably null	Het
Actrt2	A	G	4: 154,667,379	V100A	probably damaging	Het
Adra1b	A	G	11: 43,776,006	L468P	possibly damaging	Het
Ankhd1	A	G	18: 36,642,969	E1457G	probably benign	Het
Aspm	A	T	1: 139,470,517	M974L	possibly damaging	Het
Atp8a2	T	A	14: 60,008,408	I612F	probably benign	Het
Cabin1	A	G	10: 75,746,730	L284P	probably damaging	Het
Cand2	T	A	6: 115,799,969	M1106K	probably benign	Het
Ccbe1	A	T	18: 66,061,388	F376I	possibly damaging	Het
Ceacam14	A	G	7: 17,815,343	T220A	probably benign	Het
Celsr3	A	G	9: 108,827,350	D344G	probably damaging	Het
Chaf1b	A	G	16: 93,891,505	K163E	probably damaging	Het
Clec2d	C	A	6: 129,184,144	T68K	probably benign	Het
Cwc27	T	C	13: 104,811,301	T19A	probably damaging	Het
Dnah7c	A	T	1: 46,628,890	Y1519F	possibly damaging	Het
E130308A19Rik	A	T	4: 59,752,288	K467M	probably damaging	Het
Fam129b	T	C	2: 32,911,448		probably null	Het
Garnl3	T	C	2: 33,054,196	Y117C	probably damaging	Het
Gas2l3	T	C	10: 89,413,369	Y629C	probably benign	Het
Lama1	A	G	17: 67,746,873	N470D	unknown	Het
Lmtk2	T	A	5: 144,173,797	I445N	probably damaging	Het
Lrba	A	G	3: 86,354,263	D1508G	probably damaging	Het
Muc5b	A	G	7: 141,862,284	H2989R	probably benign	Het
Nln	A	T	13: 104,035,655	W638R	probably damaging	Het
Nup155	C	T	15: 8,135,895	R672*	probably null	Het
Prkcb	A	G	7: 122,594,664	Y532C	probably damaging	Het
Ptpro	A	G	6: 137,418,281		probably null	Het
Rab11fip5	A	G	6: 85,342,170	L579S	probably benign	Het
Rtca	A	G	3: 116,507,749		probably null	Het
Sdccag8	A	G	1: 176,854,627		probably null	Het
Svil	G	T	18: 5,056,437	D524Y	probably damaging	Het
Unc80	A	G	1: 66,521,477	N788S	probably benign	Het
Wdfy4	G	T	14: 33,042,512	R2140S	probably damaging	Het
Zfp518a	A	G	19: 40,913,748	K707R	probably damaging	Het

Other mutations in Nup133

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00470:Nup133	APN	8	123939083	missense	probably damaging	0.98
IGL00507:Nup133	APN	8	123918967	nonsense	probably null
IGL00585:Nup133	APN	8	123909994	missense	probably damaging	1.00
IGL00676:Nup133	APN	8	123906298	intron	probably benign
IGL00966:Nup133	APN	8	123911906	missense	probably damaging	0.98
IGL01069:Nup133	APN	8	123930982	nonsense	probably null
IGL01553:Nup133	APN	8	123915324	missense	possibly damaging	0.58
IGL01669:Nup133	APN	8	123939130	nonsense	probably null
IGL01730:Nup133	APN	8	123938233	missense	probably benign	0.00
IGL01996:Nup133	APN	8	123946595	missense	probably benign	0.00
IGL02332:Nup133	APN	8	123907832	missense	probably damaging	1.00
IGL02552:Nup133	APN	8	123929255	missense	possibly damaging	0.75
IGL02956:Nup133	APN	8	123949083	missense	probably benign	0.00
IGL03009:Nup133	APN	8	123933500	missense	possibly damaging	0.46
IGL03036:Nup133	APN	8	123946594	missense	probably benign	0.11
Cadenza	UTSW	8	123911888	frame shift	probably null
Gangen	UTSW	8	123916282	critical splice donor site	probably null
hochzeit	UTSW	8	123929343	missense	probably benign	0.00
low_road	UTSW	8	123904579	missense	probably damaging	1.00
Pathway	UTSW	8	123917446	missense	possibly damaging	0.82
Slant	UTSW	8	123916281	splice site	probably null
R0010:Nup133	UTSW	8	123904579	missense	probably damaging	1.00
R0010:Nup133	UTSW	8	123904579	missense	probably damaging	1.00
R0139:Nup133	UTSW	8	123929343	missense	probably benign	0.00
R0344:Nup133	UTSW	8	123917446	missense	possibly damaging	0.82
R0730:Nup133	UTSW	8	123949008	missense	probably benign	0.00
R1301:Nup133	UTSW	8	123917417	intron	probably benign
R1453:Nup133	UTSW	8	123915375	missense	probably benign	0.00
R1570:Nup133	UTSW	8	123949176	start codon destroyed	possibly damaging	0.82
R1607:Nup133	UTSW	8	123949035	missense	probably benign	0.02
R1773:Nup133	UTSW	8	123930983	nonsense	probably null
R1992:Nup133	UTSW	8	123906221	missense	possibly damaging	0.80
R2062:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2065:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2066:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R2068:Nup133	UTSW	8	123914575	missense	probably damaging	1.00
R4397:Nup133	UTSW	8	123944301	missense	probably benign	0.04
R4683:Nup133	UTSW	8	123930982	nonsense	probably null
R4771:Nup133	UTSW	8	123929398	missense	probably damaging	1.00
R4910:Nup133	UTSW	8	123927131	missense	possibly damaging	0.91
R4911:Nup133	UTSW	8	123927131	missense	possibly damaging	0.91
R4968:Nup133	UTSW	8	123915196	missense	probably benign	0.07
R5411:Nup133	UTSW	8	123927206	missense	probably benign
R5470:Nup133	UTSW	8	123930966	missense	probably benign	0.00
R5664:Nup133	UTSW	8	123906281	missense	probably benign	0.01
R5907:Nup133	UTSW	8	123916299	missense	possibly damaging	0.90
R6003:Nup133	UTSW	8	123938292	missense	probably damaging	0.98
R6059:Nup133	UTSW	8	123914596	missense	probably damaging	1.00
R6219:Nup133	UTSW	8	123936873	missense	possibly damaging	0.90
R6292:Nup133	UTSW	8	123917437	missense	probably benign	0.01
R6672:Nup133	UTSW	8	123916281	splice site	probably null
R6737:Nup133	UTSW	8	123906291	missense	probably damaging	0.99
R6870:Nup133	UTSW	8	123899507	missense	probably benign	0.08
R6975:Nup133	UTSW	8	123915318	missense	probably damaging	0.99
R7101:Nup133	UTSW	8	123906227	missense	possibly damaging	0.89
R7114:Nup133	UTSW	8	123915373	missense	probably benign	0.00
R7271:Nup133	UTSW	8	123922414	missense	probably benign	0.34
R7501:Nup133	UTSW	8	123922414	missense	probably benign	0.34
R8054:Nup133	UTSW	8	123949217	intron	probably benign
R8397:Nup133	UTSW	8	123922417	missense	probably benign	0.17
R8703:Nup133	UTSW	8	123916282	critical splice donor site	probably null
R8811:Nup133	UTSW	8	123911888	frame shift	probably null
R8813:Nup133	UTSW	8	123911888	frame shift	probably null
R8952:Nup133	UTSW	8	123907761	missense	probably damaging	1.00
R9116:Nup133	UTSW	8	123933416	missense	probably benign	0.00
R9340:Nup133	UTSW	8	123938142	missense	probably benign	0.38
X0023:Nup133	UTSW	8	123909988	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CATGTTCATTCAGTTTGGCTGCAG -3'
(R):5'- CAACTGCCTGTTTTGGAGAC -3'

Sequencing Primer
(F):5'- GAAGAACTCTTCCCTGCTGAG -3'
(R):5'- GGGGTTAACTGCATGTCTT -3'

Posted On

2018-08-29