Incidental Mutation 'R6763:Gas2l3'
ID531785
Institutional Source Beutler Lab
Gene Symbol Gas2l3
Ensembl Gene ENSMUSG00000074802
Gene Namegrowth arrest-specific 2 like 3
Synonyms8430435B07Rik, LOC237436
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R6763 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location89408823-89443967 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89413369 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 629 (Y629C)
Ref Sequence ENSEMBL: ENSMUSP00000100935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099374] [ENSMUST00000105298] [ENSMUST00000220128]
Predicted Effect probably benign
Transcript: ENSMUST00000099374
AA Change: Y629C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096973
Gene: ENSMUSG00000074802
AA Change: Y629C

DomainStartEndE-ValueType
CH 52 166 1.71e-9 SMART
low complexity region 179 194 N/A INTRINSIC
Pfam:GAS2 215 284 1.8e-29 PFAM
low complexity region 446 460 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105298
AA Change: Y629C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000100935
Gene: ENSMUSG00000074802
AA Change: Y629C

DomainStartEndE-ValueType
CH 52 166 1.71e-9 SMART
low complexity region 179 194 N/A INTRINSIC
Pfam:GAS2 213 286 1.5e-31 PFAM
low complexity region 446 460 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220128
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display partial postnatal lethality with none surviving past 4 months, dilated cardiomyopathy, cardiac interstitial fibrosis, and premature binucleation of cardiomyocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas C A 15: 102,340,022 R286L probably null Het
Actrt2 A G 4: 154,667,379 V100A probably damaging Het
Adra1b A G 11: 43,776,006 L468P possibly damaging Het
Ankhd1 A G 18: 36,642,969 E1457G probably benign Het
Aspm A T 1: 139,470,517 M974L possibly damaging Het
Atp8a2 T A 14: 60,008,408 I612F probably benign Het
Cabin1 A G 10: 75,746,730 L284P probably damaging Het
Cand2 T A 6: 115,799,969 M1106K probably benign Het
Ccbe1 A T 18: 66,061,388 F376I possibly damaging Het
Ceacam14 A G 7: 17,815,343 T220A probably benign Het
Celsr3 A G 9: 108,827,350 D344G probably damaging Het
Chaf1b A G 16: 93,891,505 K163E probably damaging Het
Clec2d C A 6: 129,184,144 T68K probably benign Het
Cwc27 T C 13: 104,811,301 T19A probably damaging Het
Dnah7c A T 1: 46,628,890 Y1519F possibly damaging Het
E130308A19Rik A T 4: 59,752,288 K467M probably damaging Het
Fam129b T C 2: 32,911,448 probably null Het
Garnl3 T C 2: 33,054,196 Y117C probably damaging Het
Lama1 A G 17: 67,746,873 N470D unknown Het
Lmtk2 T A 5: 144,173,797 I445N probably damaging Het
Lrba A G 3: 86,354,263 D1508G probably damaging Het
Muc5b A G 7: 141,862,284 H2989R probably benign Het
Nln A T 13: 104,035,655 W638R probably damaging Het
Nup133 T C 8: 123,944,278 I127V possibly damaging Het
Nup155 C T 15: 8,135,895 R672* probably null Het
Prkcb A G 7: 122,594,664 Y532C probably damaging Het
Ptpro A G 6: 137,418,281 probably null Het
Rab11fip5 A G 6: 85,342,170 L579S probably benign Het
Rtca A G 3: 116,507,749 probably null Het
Sdccag8 A G 1: 176,854,627 probably null Het
Svil G T 18: 5,056,437 D524Y probably damaging Het
Unc80 A G 1: 66,521,477 N788S probably benign Het
Wdfy4 G T 14: 33,042,512 R2140S probably damaging Het
Zfp518a A G 19: 40,913,748 K707R probably damaging Het
Other mutations in Gas2l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Gas2l3 APN 10 89413627 missense probably benign 0.00
IGL01148:Gas2l3 APN 10 89413504 missense probably benign 0.25
R0472:Gas2l3 UTSW 10 89426477 missense probably damaging 1.00
R0578:Gas2l3 UTSW 10 89417075 missense probably damaging 1.00
R0720:Gas2l3 UTSW 10 89413943 missense probably benign 0.00
R1386:Gas2l3 UTSW 10 89414353 missense possibly damaging 0.77
R1470:Gas2l3 UTSW 10 89413934 missense probably benign
R1470:Gas2l3 UTSW 10 89413934 missense probably benign
R1530:Gas2l3 UTSW 10 89433769 missense probably benign 0.02
R1733:Gas2l3 UTSW 10 89414265 missense probably damaging 1.00
R1772:Gas2l3 UTSW 10 89417014 unclassified probably benign
R1840:Gas2l3 UTSW 10 89422251 missense possibly damaging 0.79
R2168:Gas2l3 UTSW 10 89414098 missense probably benign 0.01
R3082:Gas2l3 UTSW 10 89430958 small deletion probably benign
R3083:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4639:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4641:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4642:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4643:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4644:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4645:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4809:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4810:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4820:Gas2l3 UTSW 10 89417045 missense probably damaging 1.00
R4852:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4853:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4855:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4865:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4900:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4906:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4926:Gas2l3 UTSW 10 89430958 small deletion probably benign
R4946:Gas2l3 UTSW 10 89413772 missense probably benign
R5072:Gas2l3 UTSW 10 89430958 small deletion probably benign
R5073:Gas2l3 UTSW 10 89430958 small deletion probably benign
R5074:Gas2l3 UTSW 10 89430958 small deletion probably benign
R5137:Gas2l3 UTSW 10 89413975 missense probably damaging 1.00
R5579:Gas2l3 UTSW 10 89414066 missense probably benign
R5919:Gas2l3 UTSW 10 89417055 missense probably damaging 1.00
R6573:Gas2l3 UTSW 10 89422210 splice site probably null
R6961:Gas2l3 UTSW 10 89413291 missense probably benign 0.00
R7491:Gas2l3 UTSW 10 89413901 missense probably benign 0.02
R7707:Gas2l3 UTSW 10 89414358 missense probably damaging 1.00
R7806:Gas2l3 UTSW 10 89413370 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCCTGATTTGCTGAAACGATAC -3'
(R):5'- GCAAAAGCTACTCAGGGATCG -3'

Sequencing Primer
(F):5'- CCTGATTTGCTGAAACGATACAAGTG -3'
(R):5'- GGTAAGAATACAGTTTCAGTTGCC -3'
Posted On2018-08-29