Incidental Mutation 'R6764:Fmn1'
ID531806
Institutional Source Beutler Lab
Gene Symbol Fmn1
Ensembl Gene ENSMUSG00000044042
Gene Nameformin 1
SynonymsFmn, formin-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R6764 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location113327736-113716767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113525215 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 667 (E667G)
Ref Sequence ENSEMBL: ENSMUSP00000125052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081349] [ENSMUST00000099576] [ENSMUST00000102547] [ENSMUST00000161731]
Predicted Effect unknown
Transcript: ENSMUST00000081349
AA Change: E539G
SMART Domains Protein: ENSMUSP00000080093
Gene: ENSMUSG00000044042
AA Change: E539G

DomainStartEndE-ValueType
Blast:FH2 25 641 N/A BLAST
SCOP:d1jvr__ 668 699 2e-3 SMART
FH2 757 1162 1.16e-137 SMART
Predicted Effect unknown
Transcript: ENSMUST00000099576
AA Change: E765G
SMART Domains Protein: ENSMUSP00000097171
Gene: ENSMUSG00000044042
AA Change: E765G

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1388 1.16e-137 SMART
Predicted Effect unknown
Transcript: ENSMUST00000102547
AA Change: E765G
SMART Domains Protein: ENSMUSP00000099606
Gene: ENSMUSG00000044042
AA Change: E765G

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 861 N/A BLAST
SCOP:d1jvr__ 894 925 2e-3 SMART
FH2 983 1424 1.03e-134 SMART
Predicted Effect unknown
Transcript: ENSMUST00000161731
AA Change: E667G
SMART Domains Protein: ENSMUSP00000125052
Gene: ENSMUSG00000044042
AA Change: E667G

DomainStartEndE-ValueType
low complexity region 159 173 N/A INTRINSIC
Blast:FH2 352 619 1e-62 BLAST
Blast:FH2 625 765 3e-53 BLAST
SCOP:d1jvr__ 796 827 2e-3 SMART
FH2 885 1290 1.16e-137 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the formin homology family and encodes a protein that has a role in the formation of adherens junction and the polymerization of linear actin cables. The homologous gene in mouse is associated with limb deformity. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous, irradiation-induced, and transgene-insertional mutations show severe syndactyly and oligodactyly of the feet, abnormal long bones (including radius-ulna fusions), and reduced or absent kidneys. Many mutants survive and breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020D05Rik A G 19: 5,502,872 S294P probably damaging Het
Aff4 G T 11: 53,399,830 R539L probably damaging Het
Aox2 T A 1: 58,350,282 Y1147N probably damaging Het
Arhgef25 A G 10: 127,184,101 F423L probably damaging Het
Atp1a2 A T 1: 172,284,614 D571E probably benign Het
Bank1 A G 3: 136,242,940 S159P probably damaging Het
Bcan C A 3: 87,988,378 R817L probably damaging Het
Cacna1g A G 11: 94,413,188 S1990P possibly damaging Het
Ccna1 G A 3: 55,046,078 T368M probably damaging Het
Chia1 T C 3: 106,130,740 probably null Het
Ctbp1 T C 5: 33,259,245 H136R possibly damaging Het
Dner T G 1: 84,494,781 D366A probably damaging Het
Eif3d A T 15: 77,961,686 D378E probably damaging Het
Evpl A G 11: 116,222,944 S1307P probably damaging Het
Fgd5 T A 6: 91,989,421 N720K probably damaging Het
Gm4846 A G 1: 166,491,552 C206R probably benign Het
Grpel1 G A 5: 36,465,225 R11H probably benign Het
Gsn A G 2: 35,284,044 Y55C probably damaging Het
Hephl1 G A 9: 15,088,921 T345I possibly damaging Het
Ints2 T A 11: 86,212,779 K1150N probably benign Het
Itga4 C A 2: 79,325,614 H975N probably benign Het
Musk T C 4: 58,354,027 V360A probably damaging Het
Naalad2 A T 9: 18,402,889 probably benign Het
Ninj2 G T 6: 120,198,050 A51S probably benign Het
Pcdhac1 T C 18: 37,090,679 Y182H probably damaging Het
Pitpnm3 A G 11: 72,051,233 F916S probably damaging Het
Sfrp5 T A 19: 42,199,799 M194L probably benign Het
Sigirr C T 7: 141,093,242 V99I probably benign Het
Smco2 A G 6: 146,871,329 D343G probably damaging Het
Snap91 A G 9: 86,792,181 I584T probably benign Het
Syne1 G A 10: 5,229,011 Q4488* probably null Het
Tbc1d24 A C 17: 24,185,780 F130C possibly damaging Het
Trpm7 A G 2: 126,844,420 V296A possibly damaging Het
Ttll11 T C 2: 35,890,448 probably null Het
Vmn2r115 A G 17: 23,346,072 D311G probably damaging Het
Vmn2r63 A G 7: 42,903,271 S854P probably damaging Het
Zfp330 C T 8: 82,767,305 C109Y probably damaging Het
Zfp534 C T 4: 147,674,718 G498D probably benign Het
Zfp62 A G 11: 49,215,169 D29G probably damaging Het
Other mutations in Fmn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Fmn1 APN 2 113444467 intron probably benign
IGL01520:Fmn1 APN 2 113444368 intron probably benign
IGL02039:Fmn1 APN 2 113365080 missense unknown
IGL02222:Fmn1 APN 2 113593109 missense probably damaging 1.00
IGL02238:Fmn1 APN 2 113582125 missense possibly damaging 0.90
IGL02373:Fmn1 APN 2 113364126 missense unknown
IGL02490:Fmn1 APN 2 113529472 splice site probably benign
IGL02506:Fmn1 APN 2 113525295 missense unknown
IGL02684:Fmn1 APN 2 113525277 missense unknown
IGL03008:Fmn1 APN 2 113365100 missense unknown
IGL03058:Fmn1 APN 2 113441814 intron probably benign
IGL03076:Fmn1 APN 2 113584092 missense probably damaging 0.99
FR4304:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4304:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4342:Fmn1 UTSW 2 113525783 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525773 small insertion probably benign
FR4589:Fmn1 UTSW 2 113525774 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525778 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525781 small insertion probably benign
FR4737:Fmn1 UTSW 2 113525784 small insertion probably benign
R0349:Fmn1 UTSW 2 113365796 missense unknown
R0452:Fmn1 UTSW 2 113636779 missense possibly damaging 0.46
R0529:Fmn1 UTSW 2 113707853 splice site probably benign
R1215:Fmn1 UTSW 2 113693030 nonsense probably null
R1471:Fmn1 UTSW 2 113693094 missense possibly damaging 0.95
R1489:Fmn1 UTSW 2 113365212 missense unknown
R1491:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R1551:Fmn1 UTSW 2 113525862 missense possibly damaging 0.70
R1558:Fmn1 UTSW 2 113693118 missense possibly damaging 0.46
R1588:Fmn1 UTSW 2 113365698 missense unknown
R1602:Fmn1 UTSW 2 113525623 missense unknown
R1690:Fmn1 UTSW 2 113525482 missense unknown
R1772:Fmn1 UTSW 2 113365355 missense unknown
R1867:Fmn1 UTSW 2 113709438 missense probably damaging 1.00
R1923:Fmn1 UTSW 2 113429721 intron probably benign
R1941:Fmn1 UTSW 2 113365143 missense unknown
R2019:Fmn1 UTSW 2 113364480 missense unknown
R2140:Fmn1 UTSW 2 113595048 missense probably benign 0.45
R2164:Fmn1 UTSW 2 113365617 missense unknown
R2395:Fmn1 UTSW 2 113365181 missense unknown
R2999:Fmn1 UTSW 2 113365094 missense unknown
R3405:Fmn1 UTSW 2 113364348 missense unknown
R3407:Fmn1 UTSW 2 113365055 missense unknown
R3771:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3772:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3773:Fmn1 UTSW 2 113582118 missense probably damaging 1.00
R3777:Fmn1 UTSW 2 113365122 missense unknown
R4166:Fmn1 UTSW 2 113636735 missense probably benign 0.33
R4477:Fmn1 UTSW 2 113444399 intron probably benign
R4614:Fmn1 UTSW 2 113365149 missense unknown
R4701:Fmn1 UTSW 2 113584071 missense possibly damaging 0.76
R4867:Fmn1 UTSW 2 113584120 critical splice donor site probably null
R5063:Fmn1 UTSW 2 113364921 missense unknown
R5224:Fmn1 UTSW 2 113365125 missense unknown
R5510:Fmn1 UTSW 2 113596369 missense probably damaging 1.00
R6083:Fmn1 UTSW 2 113364303 missense unknown
R6234:Fmn1 UTSW 2 113365655 missense unknown
R6266:Fmn1 UTSW 2 113596338 missense probably damaging 1.00
R7054:Fmn1 UTSW 2 113365008 missense unknown
R7311:Fmn1 UTSW 2 113525680 missense unknown
R7439:Fmn1 UTSW 2 113441611 missense unknown
R7440:Fmn1 UTSW 2 113441611 missense unknown
R7441:Fmn1 UTSW 2 113441611 missense unknown
R7444:Fmn1 UTSW 2 113441611 missense unknown
R7461:Fmn1 UTSW 2 113364071 missense unknown
R7526:Fmn1 UTSW 2 113688134 missense probably damaging 0.99
R7540:Fmn1 UTSW 2 113529310 splice site probably null
R7576:Fmn1 UTSW 2 113365008 missense unknown
R7657:Fmn1 UTSW 2 113525193 missense unknown
R7669:Fmn1 UTSW 2 113365477 missense unknown
R7713:Fmn1 UTSW 2 113525814 missense unknown
R7841:Fmn1 UTSW 2 113529465 critical splice donor site probably null
R7924:Fmn1 UTSW 2 113529465 critical splice donor site probably null
R8041:Fmn1 UTSW 2 113364594 missense unknown
RF003:Fmn1 UTSW 2 113525786 small insertion probably benign
RF023:Fmn1 UTSW 2 113525786 small insertion probably benign
Z1088:Fmn1 UTSW 2 113441925 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGGCCCCTAGATGTTTGTTC -3'
(R):5'- TTTCAGCATCACAGGGCTTG -3'

Sequencing Primer
(F):5'- TGGATTCTTGAACAAATGTCTCC -3'
(R):5'- CAGGGCTTGAGGAAGGTCTCTC -3'
Posted On2018-08-29