Mutagenetix > Incidental Mutations

Incidental Mutation 'R6764:Aff4'

531827

Institutional Source

Beutler Lab

Gene Symbol

Aff4

Ensembl Gene

ENSMUSG00000049470

Gene Name

AF4/FMR2 family, member 4

Synonyms

Laf4l, Alf4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6764 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

53350833-53421830 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 53399830 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 539 (R539L)

Ref Sequence

ENSEMBL: ENSMUSP00000051479 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060945]

AlphaFold

Q9ESC8

Predicted Effect

probably damaging
Transcript: ENSMUST00000060945
AA Change: R539L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: R539L

Domain	Start	End	E-Value	Type
Pfam:AF-4	2	1156	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000152616

SMART Domains

Protein: ENSMUSP00000118866
Gene: ENSMUSG00000049470

Domain	Start	End	E-Value	Type
Pfam:AF-4	1	51	4e-15	PFAM
Pfam:AF-4	46	159	1.3e-30	PFAM

Meta Mutation Damage Score

0.1312

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.5%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020D05Rik	A	G	19: 5,502,872	S294P	probably damaging	Het
Aox2	T	A	1: 58,350,282	Y1147N	probably damaging	Het
Arhgef25	A	G	10: 127,184,101	F423L	probably damaging	Het
Atp1a2	A	T	1: 172,284,614	D571E	probably benign	Het
Bank1	A	G	3: 136,242,940	S159P	probably damaging	Het
Bcan	C	A	3: 87,988,378	R817L	probably damaging	Het
Cacna1g	A	G	11: 94,413,188	S1990P	possibly damaging	Het
Ccna1	G	A	3: 55,046,078	T368M	probably damaging	Het
Chia1	T	C	3: 106,130,740		probably null	Het
Ctbp1	T	C	5: 33,259,245	H136R	possibly damaging	Het
Dner	T	G	1: 84,494,781	D366A	probably damaging	Het
Eif3d	A	T	15: 77,961,686	D378E	probably damaging	Het
Evpl	A	G	11: 116,222,944	S1307P	probably damaging	Het
Fgd5	T	A	6: 91,989,421	N720K	probably damaging	Het
Fmn1	A	G	2: 113,525,215	E667G	unknown	Het
Gm4846	A	G	1: 166,491,552	C206R	probably benign	Het
Grpel1	G	A	5: 36,465,225	R11H	probably benign	Het
Gsn	A	G	2: 35,284,044	Y55C	probably damaging	Het
Hephl1	G	A	9: 15,088,921	T345I	possibly damaging	Het
Ints2	T	A	11: 86,212,779	K1150N	probably benign	Het
Itga4	C	A	2: 79,325,614	H975N	probably benign	Het
Musk	T	C	4: 58,354,027	V360A	probably damaging	Het
Naalad2	A	T	9: 18,402,889		probably benign	Het
Ninj2	G	T	6: 120,198,050	A51S	probably benign	Het
Pcdhac1	T	C	18: 37,090,679	Y182H	probably damaging	Het
Pitpnm3	A	G	11: 72,051,233	F916S	probably damaging	Het
Sfrp5	T	A	19: 42,199,799	M194L	probably benign	Het
Sigirr	C	T	7: 141,093,242	V99I	probably benign	Het
Smco2	A	G	6: 146,871,329	D343G	probably damaging	Het
Snap91	A	G	9: 86,792,181	I584T	probably benign	Het
Syne1	G	A	10: 5,229,011	Q4488*	probably null	Het
Tbc1d24	A	C	17: 24,185,780	F130C	possibly damaging	Het
Trpm7	A	G	2: 126,844,420	V296A	possibly damaging	Het
Ttll11	T	C	2: 35,890,448		probably null	Het
Vmn2r115	A	G	17: 23,346,072	D311G	probably damaging	Het
Vmn2r63	A	G	7: 42,903,271	S854P	probably damaging	Het
Zfp330	C	T	8: 82,767,305	C109Y	probably damaging	Het
Zfp534	C	T	4: 147,674,718	G498D	probably benign	Het
Zfp62	A	G	11: 49,215,169	D29G	probably damaging	Het

Other mutations in Aff4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00793:Aff4	APN	11	53411990	missense	probably damaging	0.98
IGL01348:Aff4	APN	11	53402500	missense	probably benign
IGL01446:Aff4	APN	11	53415469	missense	probably damaging	0.99
IGL02151:Aff4	APN	11	53399806	missense	probably benign
IGL02526:Aff4	APN	11	53406682	splice site	probably benign
IGL02567:Aff4	APN	11	53372751	missense	possibly damaging	0.64
IGL02633:Aff4	APN	11	53409371	splice site	probably benign
IGL02707:Aff4	APN	11	53399740	missense	probably benign
R0090:Aff4	UTSW	11	53392782	missense	probably benign	0.01
R0128:Aff4	UTSW	11	53415466	missense	probably damaging	0.99
R0243:Aff4	UTSW	11	53397858	missense	possibly damaging	0.74
R0345:Aff4	UTSW	11	53372881	missense	probably benign	0.00
R0347:Aff4	UTSW	11	53400088	missense	probably benign	0.01
R0732:Aff4	UTSW	11	53375596	missense	probably benign
R0737:Aff4	UTSW	11	53410953	nonsense	probably null
R1464:Aff4	UTSW	11	53372524	missense	probably damaging	0.97
R1464:Aff4	UTSW	11	53372524	missense	probably damaging	0.97
R1500:Aff4	UTSW	11	53372378	missense	probably benign	0.00
R1693:Aff4	UTSW	11	53396553	missense	probably damaging	1.00
R1743:Aff4	UTSW	11	53368695	missense	possibly damaging	0.65
R1961:Aff4	UTSW	11	53372999	missense	probably damaging	1.00
R2048:Aff4	UTSW	11	53398385	missense	probably benign	0.39
R2138:Aff4	UTSW	11	53372512	missense	possibly damaging	0.94
R2155:Aff4	UTSW	11	53399619	missense	probably damaging	1.00
R2379:Aff4	UTSW	11	53408478	splice site	probably benign
R4156:Aff4	UTSW	11	53410899	intron	probably benign
R5001:Aff4	UTSW	11	53404357	missense	probably damaging	1.00
R5281:Aff4	UTSW	11	53372288	missense	probably damaging	1.00
R5477:Aff4	UTSW	11	53408472	critical splice donor site	probably null
R5677:Aff4	UTSW	11	53400275	missense	possibly damaging	0.55
R5992:Aff4	UTSW	11	53373010	missense	probably damaging	0.99
R6576:Aff4	UTSW	11	53400441	missense	probably damaging	1.00
R6988:Aff4	UTSW	11	53398237	missense	probably damaging	1.00
R7034:Aff4	UTSW	11	53408409	missense	probably damaging	0.99
R7177:Aff4	UTSW	11	53406639	missense	probably benign	0.10
R7426:Aff4	UTSW	11	53372875	missense	probably damaging	1.00
R7755:Aff4	UTSW	11	53398379	missense	probably damaging	0.97
R7848:Aff4	UTSW	11	53404512	missense	probably benign	0.05
R7968:Aff4	UTSW	11	53409348	missense	probably damaging	1.00
R8159:Aff4	UTSW	11	53411894	missense	possibly damaging	0.71
R8218:Aff4	UTSW	11	53398257	missense	probably damaging	0.98
R8241:Aff4	UTSW	11	53400171	missense	probably benign	0.00
R8284:Aff4	UTSW	11	53404552	missense	probably damaging	0.99
R8373:Aff4	UTSW	11	53400267	nonsense	probably null
R8695:Aff4	UTSW	11	53368682	missense	probably damaging	1.00
R8777:Aff4	UTSW	11	53399956	missense	probably damaging	1.00
R8777-TAIL:Aff4	UTSW	11	53399956	missense	probably damaging	1.00
R8780:Aff4	UTSW	11	53380617	missense	probably damaging	1.00
R8798:Aff4	UTSW	11	53400508	critical splice donor site	probably benign
R8838:Aff4	UTSW	11	53406638	missense	possibly damaging	0.77
R8939:Aff4	UTSW	11	53372404	missense	probably benign
R9146:Aff4	UTSW	11	53408136	missense	probably benign	0.06
R9329:Aff4	UTSW	11	53397859	missense	probably damaging	1.00
R9378:Aff4	UTSW	11	53372479	missense	probably damaging	0.98
R9471:Aff4	UTSW	11	53380646	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- CAGCTTCCTCTGTAGACAGC -3'
(R):5'- GGTCGAGGAGAAGATTTTGATTCC -3'

Sequencing Primer
(F):5'- GCTTCCTCTGTAGACAGCAACATC -3'
(R):5'- ATGTTGGGTTTCCTCGAGCCC -3'

Posted On

2018-08-29