Mutagenetix > Incidental Mutation

Incidental Mutation 'R6764:Ints2'

531829

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6764 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 86212779 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 1150 (K1150N)

Ref Sequence

ENSEMBL: ENSMUSP00000103674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]

AlphaFold

Q80UK8

Predicted Effect

probably benign
Transcript: ENSMUST00000018212
AA Change: K1150N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: K1150N

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108039
AA Change: K1150N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: K1150N

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Meta Mutation Damage Score

0.0594

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.5%

Validation Efficiency

100% (39/39)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020D05Rik	A	G	19: 5,502,872	S294P	probably damaging	Het
Aff4	G	T	11: 53,399,830	R539L	probably damaging	Het
Aox2	T	A	1: 58,350,282	Y1147N	probably damaging	Het
Arhgef25	A	G	10: 127,184,101	F423L	probably damaging	Het
Atp1a2	A	T	1: 172,284,614	D571E	probably benign	Het
Bank1	A	G	3: 136,242,940	S159P	probably damaging	Het
Bcan	C	A	3: 87,988,378	R817L	probably damaging	Het
Cacna1g	A	G	11: 94,413,188	S1990P	possibly damaging	Het
Ccna1	G	A	3: 55,046,078	T368M	probably damaging	Het
Chia1	T	C	3: 106,130,740		probably null	Het
Ctbp1	T	C	5: 33,259,245	H136R	possibly damaging	Het
Dner	T	G	1: 84,494,781	D366A	probably damaging	Het
Eif3d	A	T	15: 77,961,686	D378E	probably damaging	Het
Evpl	A	G	11: 116,222,944	S1307P	probably damaging	Het
Fgd5	T	A	6: 91,989,421	N720K	probably damaging	Het
Fmn1	A	G	2: 113,525,215	E667G	unknown	Het
Gm4846	A	G	1: 166,491,552	C206R	probably benign	Het
Grpel1	G	A	5: 36,465,225	R11H	probably benign	Het
Gsn	A	G	2: 35,284,044	Y55C	probably damaging	Het
Hephl1	G	A	9: 15,088,921	T345I	possibly damaging	Het
Itga4	C	A	2: 79,325,614	H975N	probably benign	Het
Musk	T	C	4: 58,354,027	V360A	probably damaging	Het
Naalad2	A	T	9: 18,402,889		probably benign	Het
Ninj2	G	T	6: 120,198,050	A51S	probably benign	Het
Pcdhac1	T	C	18: 37,090,679	Y182H	probably damaging	Het
Pitpnm3	A	G	11: 72,051,233	F916S	probably damaging	Het
Sfrp5	T	A	19: 42,199,799	M194L	probably benign	Het
Sigirr	C	T	7: 141,093,242	V99I	probably benign	Het
Smco2	A	G	6: 146,871,329	D343G	probably damaging	Het
Snap91	A	G	9: 86,792,181	I584T	probably benign	Het
Syne1	G	A	10: 5,229,011	Q4488*	probably null	Het
Tbc1d24	A	C	17: 24,185,780	F130C	possibly damaging	Het
Trpm7	A	G	2: 126,844,420	V296A	possibly damaging	Het
Ttll11	T	C	2: 35,890,448		probably null	Het
Vmn2r115	A	G	17: 23,346,072	D311G	probably damaging	Het
Vmn2r63	A	G	7: 42,903,271	S854P	probably damaging	Het
Zfp330	C	T	8: 82,767,305	C109Y	probably damaging	Het
Zfp534	C	T	4: 147,674,718	G498D	probably benign	Het
Zfp62	A	G	11: 49,215,169	D29G	probably damaging	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null
R8942:Ints2	UTSW	11	86212894	missense	probably benign	0.00
R9037:Ints2	UTSW	11	86215704	missense	probably benign
R9154:Ints2	UTSW	11	86234698	missense	probably damaging	1.00
R9397:Ints2	UTSW	11	86244485	missense	probably benign	0.01
R9412:Ints2	UTSW	11	86226763	missense	probably damaging	0.99
R9472:Ints2	UTSW	11	86242998	missense
R9476:Ints2	UTSW	11	86244509	missense	probably benign
R9510:Ints2	UTSW	11	86244509	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCCAGATTCAGTATAGCAAGTGG -3'
(R):5'- GTCGAGCATTTCCTCCACTG -3'

Sequencing Primer
(F):5'- GCAAGTGGCTGCACTTAAAAC -3'
(R):5'- GAGCATTTCCTCCACTGTATGAGG -3'

Posted On

2018-08-29