Incidental Mutation 'R6765:Atp2c2'
ID 531864
Institutional Source Beutler Lab
Gene Symbol Atp2c2
Ensembl Gene ENSMUSG00000034112
Gene Name ATPase, Ca++ transporting, type 2C, member 2
Synonyms 1810010G06Rik
MMRRC Submission 044881-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6765 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 120426748-120484456 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 120479756 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 762 (I762F)
Ref Sequence ENSEMBL: ENSMUSP00000092794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095171]
AlphaFold A7L9Z8
Predicted Effect probably damaging
Transcript: ENSMUST00000095171
AA Change: I762F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: I762F

DomainStartEndE-ValueType
Cation_ATPase_N 54 128 1.27e-12 SMART
Pfam:E1-E2_ATPase 133 366 1.7e-62 PFAM
Pfam:Hydrolase 371 684 5.3e-18 PFAM
Pfam:HAD 374 681 7.4e-11 PFAM
Pfam:Cation_ATPase 437 521 1.1e-17 PFAM
Pfam:Cation_ATPase_C 754 927 1.1e-47 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 C A 7: 82,216,232 (GRCm39) D878E possibly damaging Het
Adipor2 A C 6: 119,334,203 (GRCm39) F336V possibly damaging Het
Akt3 A T 1: 176,877,756 (GRCm39) Y337* probably null Het
Aoc1 A G 6: 48,882,871 (GRCm39) N249S probably benign Het
Ap1b1 T A 11: 4,969,427 (GRCm39) L261Q probably damaging Het
Ap3b1 T A 13: 94,599,017 (GRCm39) D530E probably benign Het
Arid4b T A 13: 14,361,900 (GRCm39) M788K possibly damaging Het
Bhlhe23 C A 2: 180,418,136 (GRCm39) R134L probably damaging Het
Cacna2d3 T C 14: 28,777,934 (GRCm39) D687G probably damaging Het
Ccdc136 G A 6: 29,405,940 (GRCm39) M95I probably benign Het
Cdk12 T A 11: 98,115,355 (GRCm39) I832N unknown Het
Clcn2 A C 16: 20,526,418 (GRCm39) probably null Het
Csrnp2 C T 15: 100,380,574 (GRCm39) R239Q probably damaging Het
Dhrs13 T A 11: 77,927,965 (GRCm39) D270E probably benign Het
Dlgap2 G A 8: 14,793,284 (GRCm39) G426D probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Fam120a A G 13: 49,045,440 (GRCm39) Y799H probably damaging Het
Farp1 G A 14: 121,460,066 (GRCm39) V112I probably benign Het
Fhip2a A G 19: 57,367,177 (GRCm39) D240G probably benign Het
Fsip2 A G 2: 82,816,776 (GRCm39) I4170V probably benign Het
Gm12185 A G 11: 48,806,531 (GRCm39) V220A probably benign Het
Gpr37l1 T C 1: 135,094,860 (GRCm39) Y128C probably damaging Het
Gsto2 A T 19: 47,860,227 (GRCm39) R7* probably null Het
Itih3 C T 14: 30,631,430 (GRCm39) G822D probably benign Het
Kcnu1 A T 8: 26,403,673 (GRCm39) D728V probably damaging Het
Khdc4 G T 3: 88,593,736 (GRCm39) G42W probably damaging Het
Lnpep G A 17: 17,750,758 (GRCm39) T976I probably damaging Het
Map1b A C 13: 99,562,449 (GRCm39) H2420Q unknown Het
Mc1r A G 8: 124,134,435 (GRCm39) K63E probably damaging Het
Mpped1 G A 15: 83,720,584 (GRCm39) V15M probably damaging Het
Ncor1 T C 11: 62,264,272 (GRCm39) T103A probably benign Het
Nhsl1 A T 10: 18,407,062 (GRCm39) T1399S probably benign Het
Nlrc5 C T 8: 95,216,996 (GRCm39) T995M probably benign Het
Nrbp1 G A 5: 31,403,190 (GRCm39) probably null Het
Or10g9 A C 9: 39,912,493 (GRCm39) F10C probably damaging Het
Or4c116 G T 2: 88,942,640 (GRCm39) T72N possibly damaging Het
Or8k27 T C 2: 86,275,580 (GRCm39) T249A probably benign Het
Pcdhb13 T C 18: 37,576,663 (GRCm39) L347P probably damaging Het
Pkhd1 T C 1: 20,128,563 (GRCm39) T4047A probably benign Het
Prrt2 T A 7: 126,618,769 (GRCm39) D232V probably damaging Het
Psmd5 A C 2: 34,746,545 (GRCm39) M344R probably benign Het
Pwp1 G A 10: 85,720,397 (GRCm39) E345K probably damaging Het
Qsox1 A G 1: 155,666,851 (GRCm39) Y213H probably benign Het
Rmc1 A G 18: 12,309,203 (GRCm39) N92D possibly damaging Het
Sclt1 T C 3: 41,685,337 (GRCm39) R39G unknown Het
Syne1 A T 10: 5,093,285 (GRCm39) probably null Het
Tmem163 G T 1: 127,479,078 (GRCm39) A147E probably damaging Het
Trav13n-4 A T 14: 53,601,557 (GRCm39) M109L probably benign Het
Trp53bp1 T C 2: 121,039,790 (GRCm39) E1283G probably damaging Het
Trpm6 T A 19: 18,855,129 (GRCm39) D1929E probably damaging Het
Upb1 A T 10: 75,273,978 (GRCm39) D335V probably damaging Het
Vps26b T C 9: 26,924,104 (GRCm39) E213G probably damaging Het
Vwc2 C T 11: 11,104,215 (GRCm39) T249I probably benign Het
Wwc2 A G 8: 48,353,826 (GRCm39) Y103H possibly damaging Het
Zan A G 5: 137,391,409 (GRCm39) C4692R unknown Het
Zfp106 T C 2: 120,369,935 (GRCm39) E29G probably damaging Het
Zfp551 G A 7: 12,150,767 (GRCm39) A214V possibly damaging Het
Zfp981 T A 4: 146,622,363 (GRCm39) H429Q probably benign Het
Other mutations in Atp2c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Atp2c2 APN 8 120,472,329 (GRCm39) missense probably benign
IGL01624:Atp2c2 APN 8 120,484,189 (GRCm39) missense probably benign 0.00
IGL02133:Atp2c2 APN 8 120,481,074 (GRCm39) missense probably benign 0.00
IGL02221:Atp2c2 APN 8 120,471,073 (GRCm39) missense probably damaging 1.00
IGL02606:Atp2c2 APN 8 120,457,013 (GRCm39) missense probably benign
IGL02657:Atp2c2 APN 8 120,479,771 (GRCm39) missense probably damaging 1.00
IGL02839:Atp2c2 APN 8 120,475,859 (GRCm39) missense possibly damaging 0.85
IGL03122:Atp2c2 APN 8 120,469,414 (GRCm39) missense possibly damaging 0.77
R0031:Atp2c2 UTSW 8 120,475,801 (GRCm39) missense probably benign 0.15
R0372:Atp2c2 UTSW 8 120,484,180 (GRCm39) missense probably benign
R0502:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0503:Atp2c2 UTSW 8 120,461,316 (GRCm39) missense probably null 0.99
R0584:Atp2c2 UTSW 8 120,465,157 (GRCm39) missense probably benign 0.01
R1225:Atp2c2 UTSW 8 120,461,984 (GRCm39) missense probably damaging 1.00
R1580:Atp2c2 UTSW 8 120,479,726 (GRCm39) missense probably benign 0.00
R1620:Atp2c2 UTSW 8 120,475,865 (GRCm39) missense probably benign
R1638:Atp2c2 UTSW 8 120,482,742 (GRCm39) missense possibly damaging 0.82
R1745:Atp2c2 UTSW 8 120,451,833 (GRCm39) missense probably benign 0.02
R1746:Atp2c2 UTSW 8 120,461,182 (GRCm39) unclassified probably benign
R1907:Atp2c2 UTSW 8 120,476,615 (GRCm39) splice site probably benign
R2104:Atp2c2 UTSW 8 120,476,584 (GRCm39) missense probably benign
R2151:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2152:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2154:Atp2c2 UTSW 8 120,482,841 (GRCm39) missense probably benign
R2207:Atp2c2 UTSW 8 120,475,048 (GRCm39) missense probably damaging 1.00
R3874:Atp2c2 UTSW 8 120,462,035 (GRCm39) missense possibly damaging 0.74
R3912:Atp2c2 UTSW 8 120,448,015 (GRCm39) missense probably damaging 1.00
R4093:Atp2c2 UTSW 8 120,476,610 (GRCm39) critical splice donor site probably null
R4782:Atp2c2 UTSW 8 120,475,891 (GRCm39) missense probably damaging 0.97
R4801:Atp2c2 UTSW 8 120,474,426 (GRCm39) missense probably damaging 1.00
R4973:Atp2c2 UTSW 8 120,481,002 (GRCm39) missense probably benign 0.00
R5485:Atp2c2 UTSW 8 120,479,801 (GRCm39) critical splice donor site probably null
R5978:Atp2c2 UTSW 8 120,476,614 (GRCm39) splice site probably null
R6377:Atp2c2 UTSW 8 120,453,093 (GRCm39) missense probably benign 0.10
R6613:Atp2c2 UTSW 8 120,482,760 (GRCm39) missense probably damaging 0.99
R6836:Atp2c2 UTSW 8 120,461,154 (GRCm39) missense probably damaging 1.00
R6963:Atp2c2 UTSW 8 120,457,006 (GRCm39) nonsense probably null
R7220:Atp2c2 UTSW 8 120,472,300 (GRCm39) missense probably benign 0.00
R7238:Atp2c2 UTSW 8 120,469,160 (GRCm39) missense possibly damaging 0.73
R7373:Atp2c2 UTSW 8 120,456,991 (GRCm39) missense probably benign 0.02
R7438:Atp2c2 UTSW 8 120,474,936 (GRCm39) missense probably damaging 1.00
R7573:Atp2c2 UTSW 8 120,478,008 (GRCm39) missense probably damaging 1.00
R7677:Atp2c2 UTSW 8 120,474,915 (GRCm39) missense probably benign 0.00
R7737:Atp2c2 UTSW 8 120,469,134 (GRCm39) missense probably damaging 1.00
R7912:Atp2c2 UTSW 8 120,456,917 (GRCm39) missense possibly damaging 0.81
R8821:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R8831:Atp2c2 UTSW 8 120,476,033 (GRCm39) splice site probably null
R9200:Atp2c2 UTSW 8 120,474,999 (GRCm39) nonsense probably null
R9211:Atp2c2 UTSW 8 120,446,032 (GRCm39) missense probably benign
R9246:Atp2c2 UTSW 8 120,456,989 (GRCm39) missense probably damaging 1.00
R9285:Atp2c2 UTSW 8 120,465,141 (GRCm39) missense probably benign 0.00
RF004:Atp2c2 UTSW 8 120,479,561 (GRCm39) missense probably damaging 1.00
RF012:Atp2c2 UTSW 8 120,472,253 (GRCm39) missense possibly damaging 0.91
Z1177:Atp2c2 UTSW 8 120,461,124 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAACATCAAGAACTTTGTCCG -3'
(R):5'- GCCTGACTTTACAGTGGGAC -3'

Sequencing Primer
(F):5'- GTTTCCAGCTGAGCACGTAAGC -3'
(R):5'- TGACTTTACAGTGGGACCGAGC -3'
Posted On 2018-08-29