Incidental Mutation 'R6765:Or10g9'
ID 531867
Institutional Source Beutler Lab
Gene Symbol Or10g9
Ensembl Gene ENSMUSG00000059473
Gene Name olfactory receptor family 10 subfamily G member 9
Synonyms MOR223-1, Olfr979, GA_x6K02T2PVTD-33699706-33698771
MMRRC Submission 044881-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R6765 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 39911502-39912546 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 39912493 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Cysteine at position 10 (F10C)
Ref Sequence ENSEMBL: ENSMUSP00000148903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073932] [ENSMUST00000080835] [ENSMUST00000215523] [ENSMUST00000216463]
AlphaFold Q8VH10
Predicted Effect probably benign
Transcript: ENSMUST00000073932
SMART Domains Protein: ENSMUSP00000091386
Gene: ENSMUSG00000060254

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.4e-55 PFAM
Pfam:7tm_1 39 287 5.4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080835
AA Change: F10C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079648
Gene: ENSMUSG00000059473
AA Change: F10C

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 7.9e-58 PFAM
Pfam:7tm_1 39 287 5.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215523
AA Change: F10C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216463
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 C A 7: 82,216,232 (GRCm39) D878E possibly damaging Het
Adipor2 A C 6: 119,334,203 (GRCm39) F336V possibly damaging Het
Akt3 A T 1: 176,877,756 (GRCm39) Y337* probably null Het
Aoc1 A G 6: 48,882,871 (GRCm39) N249S probably benign Het
Ap1b1 T A 11: 4,969,427 (GRCm39) L261Q probably damaging Het
Ap3b1 T A 13: 94,599,017 (GRCm39) D530E probably benign Het
Arid4b T A 13: 14,361,900 (GRCm39) M788K possibly damaging Het
Atp2c2 A T 8: 120,479,756 (GRCm39) I762F probably damaging Het
Bhlhe23 C A 2: 180,418,136 (GRCm39) R134L probably damaging Het
Cacna2d3 T C 14: 28,777,934 (GRCm39) D687G probably damaging Het
Ccdc136 G A 6: 29,405,940 (GRCm39) M95I probably benign Het
Cdk12 T A 11: 98,115,355 (GRCm39) I832N unknown Het
Clcn2 A C 16: 20,526,418 (GRCm39) probably null Het
Csrnp2 C T 15: 100,380,574 (GRCm39) R239Q probably damaging Het
Dhrs13 T A 11: 77,927,965 (GRCm39) D270E probably benign Het
Dlgap2 G A 8: 14,793,284 (GRCm39) G426D probably benign Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Fam120a A G 13: 49,045,440 (GRCm39) Y799H probably damaging Het
Farp1 G A 14: 121,460,066 (GRCm39) V112I probably benign Het
Fhip2a A G 19: 57,367,177 (GRCm39) D240G probably benign Het
Fsip2 A G 2: 82,816,776 (GRCm39) I4170V probably benign Het
Gm12185 A G 11: 48,806,531 (GRCm39) V220A probably benign Het
Gpr37l1 T C 1: 135,094,860 (GRCm39) Y128C probably damaging Het
Gsto2 A T 19: 47,860,227 (GRCm39) R7* probably null Het
Itih3 C T 14: 30,631,430 (GRCm39) G822D probably benign Het
Kcnu1 A T 8: 26,403,673 (GRCm39) D728V probably damaging Het
Khdc4 G T 3: 88,593,736 (GRCm39) G42W probably damaging Het
Lnpep G A 17: 17,750,758 (GRCm39) T976I probably damaging Het
Map1b A C 13: 99,562,449 (GRCm39) H2420Q unknown Het
Mc1r A G 8: 124,134,435 (GRCm39) K63E probably damaging Het
Mpped1 G A 15: 83,720,584 (GRCm39) V15M probably damaging Het
Ncor1 T C 11: 62,264,272 (GRCm39) T103A probably benign Het
Nhsl1 A T 10: 18,407,062 (GRCm39) T1399S probably benign Het
Nlrc5 C T 8: 95,216,996 (GRCm39) T995M probably benign Het
Nrbp1 G A 5: 31,403,190 (GRCm39) probably null Het
Or4c116 G T 2: 88,942,640 (GRCm39) T72N possibly damaging Het
Or8k27 T C 2: 86,275,580 (GRCm39) T249A probably benign Het
Pcdhb13 T C 18: 37,576,663 (GRCm39) L347P probably damaging Het
Pkhd1 T C 1: 20,128,563 (GRCm39) T4047A probably benign Het
Prrt2 T A 7: 126,618,769 (GRCm39) D232V probably damaging Het
Psmd5 A C 2: 34,746,545 (GRCm39) M344R probably benign Het
Pwp1 G A 10: 85,720,397 (GRCm39) E345K probably damaging Het
Qsox1 A G 1: 155,666,851 (GRCm39) Y213H probably benign Het
Rmc1 A G 18: 12,309,203 (GRCm39) N92D possibly damaging Het
Sclt1 T C 3: 41,685,337 (GRCm39) R39G unknown Het
Syne1 A T 10: 5,093,285 (GRCm39) probably null Het
Tmem163 G T 1: 127,479,078 (GRCm39) A147E probably damaging Het
Trav13n-4 A T 14: 53,601,557 (GRCm39) M109L probably benign Het
Trp53bp1 T C 2: 121,039,790 (GRCm39) E1283G probably damaging Het
Trpm6 T A 19: 18,855,129 (GRCm39) D1929E probably damaging Het
Upb1 A T 10: 75,273,978 (GRCm39) D335V probably damaging Het
Vps26b T C 9: 26,924,104 (GRCm39) E213G probably damaging Het
Vwc2 C T 11: 11,104,215 (GRCm39) T249I probably benign Het
Wwc2 A G 8: 48,353,826 (GRCm39) Y103H possibly damaging Het
Zan A G 5: 137,391,409 (GRCm39) C4692R unknown Het
Zfp106 T C 2: 120,369,935 (GRCm39) E29G probably damaging Het
Zfp551 G A 7: 12,150,767 (GRCm39) A214V possibly damaging Het
Zfp981 T A 4: 146,622,363 (GRCm39) H429Q probably benign Het
Other mutations in Or10g9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02718:Or10g9 APN 9 39,912,182 (GRCm39) missense probably damaging 1.00
IGL02939:Or10g9 APN 9 39,912,194 (GRCm39) missense probably benign 0.26
IGL02991:Or10g9 UTSW 9 39,911,698 (GRCm39) missense probably damaging 1.00
R1388:Or10g9 UTSW 9 39,911,948 (GRCm39) missense probably damaging 0.99
R1572:Or10g9 UTSW 9 39,912,490 (GRCm39) missense probably benign 0.35
R2089:Or10g9 UTSW 9 39,912,500 (GRCm39) missense probably benign 0.01
R2091:Or10g9 UTSW 9 39,912,500 (GRCm39) missense probably benign 0.01
R2091:Or10g9 UTSW 9 39,912,500 (GRCm39) missense probably benign 0.01
R2179:Or10g9 UTSW 9 39,912,220 (GRCm39) missense probably benign 0.44
R3424:Or10g9 UTSW 9 39,911,830 (GRCm39) missense probably damaging 0.97
R3964:Or10g9 UTSW 9 39,911,767 (GRCm39) missense possibly damaging 0.95
R3965:Or10g9 UTSW 9 39,911,767 (GRCm39) missense possibly damaging 0.95
R4111:Or10g9 UTSW 9 39,912,194 (GRCm39) nonsense probably null
R4537:Or10g9 UTSW 9 39,911,616 (GRCm39) missense probably benign 0.01
R4737:Or10g9 UTSW 9 39,911,718 (GRCm39) missense probably damaging 0.96
R4926:Or10g9 UTSW 9 39,912,319 (GRCm39) splice site probably null
R5303:Or10g9 UTSW 9 39,911,884 (GRCm39) missense probably damaging 1.00
R5587:Or10g9 UTSW 9 39,911,917 (GRCm39) missense possibly damaging 0.90
R6387:Or10g9 UTSW 9 39,912,148 (GRCm39) missense probably damaging 0.99
R6394:Or10g9 UTSW 9 39,912,001 (GRCm39) missense probably benign 0.04
R7312:Or10g9 UTSW 9 39,912,106 (GRCm39) missense probably benign 0.22
R7463:Or10g9 UTSW 9 39,911,860 (GRCm39) missense probably benign 0.07
R7486:Or10g9 UTSW 9 39,912,181 (GRCm39) missense probably benign 0.39
R7581:Or10g9 UTSW 9 39,911,718 (GRCm39) missense probably damaging 0.96
R8364:Or10g9 UTSW 9 39,911,660 (GRCm39) missense probably benign 0.22
R8414:Or10g9 UTSW 9 39,912,241 (GRCm39) missense probably benign 0.19
R9049:Or10g9 UTSW 9 39,911,919 (GRCm39) missense possibly damaging 0.56
R9567:Or10g9 UTSW 9 39,912,367 (GRCm39) missense possibly damaging 0.95
R9632:Or10g9 UTSW 9 39,912,172 (GRCm39) missense probably damaging 1.00
R9710:Or10g9 UTSW 9 39,912,172 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTACTGTGACTGTGGAGAACC -3'
(R):5'- CTGTGAGAATTCTTCGTGCTTC -3'

Sequencing Primer
(F):5'- CCACATATCAATAAAGGAGAGGTTG -3'
(R):5'- GTGAGAATTCTTCGTGCTTCTAAATC -3'
Posted On 2018-08-29