Incidental Mutation 'R6766:Yod1'
ID531899
Institutional Source Beutler Lab
Gene Symbol Yod1
Ensembl Gene ENSMUSG00000046404
Gene NameYOD1 deubiquitinase
Synonyms9930028C20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6766 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location130717327-130724358 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 130719271 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 295 (L295*)
Ref Sequence ENSEMBL: ENSMUSP00000055318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049813] [ENSMUST00000050406] [ENSMUST00000066863] [ENSMUST00000169659] [ENSMUST00000171479] [ENSMUST00000185233] [ENSMUST00000186777] [ENSMUST00000186867] [ENSMUST00000187089] [ENSMUST00000188520] [ENSMUST00000189167] [ENSMUST00000189534] [ENSMUST00000191301] [ENSMUST00000191347]
PDB Structure
Solution NMR Structure of Ubiquitin thioesterase OTU1 (EC 3.1.2.-) from Mus musculus, Northeast Structural Genomics Consortium Target MmT2A [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000049813
AA Change: L295*
SMART Domains Protein: ENSMUSP00000055318
Gene: ENSMUSG00000046404
AA Change: L295*

DomainStartEndE-ValueType
PDB:2KZR|A 42 127 3e-54 PDB
Blast:UBQ 43 118 2e-20 BLAST
Pfam:OTU 150 268 3.4e-8 PFAM
ZnF_C2H2 313 337 2.12e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050406
SMART Domains Protein: ENSMUSP00000133073
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 8.1e-107 PFAM
Pfam:KTI12 40 206 9.6e-8 PFAM
Pfam:AAA_33 42 198 3.1e-9 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066863
SMART Domains Protein: ENSMUSP00000066426
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 207 3.5e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169659
SMART Domains Protein: ENSMUSP00000127587
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.3e-106 PFAM
Pfam:KTI12 41 207 4.3e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171479
SMART Domains Protein: ENSMUSP00000129747
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 208 3.7e-8 PFAM
Pfam:AAA_33 42 199 1.1e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185233
SMART Domains Protein: ENSMUSP00000140551
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 207 3.5e-8 PFAM
Pfam:AAA_33 42 199 1.2e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186777
Predicted Effect probably benign
Transcript: ENSMUST00000186867
Predicted Effect probably benign
Transcript: ENSMUST00000187089
SMART Domains Protein: ENSMUSP00000140612
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1e-103 PFAM
Pfam:KTI12 41 207 2.3e-5 PFAM
Pfam:AAA_33 42 199 1.4e-8 PFAM
PGAM 253 400 2.9e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188520
SMART Domains Protein: ENSMUSP00000140786
Gene: ENSMUSG00000101904

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 6.3e-107 PFAM
Pfam:KTI12 41 209 2.3e-8 PFAM
Pfam:AAA_33 42 199 6.4e-11 PFAM
PGAM 253 342 1.31e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189167
SMART Domains Protein: ENSMUSP00000140984
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 6.3e-107 PFAM
Pfam:KTI12 41 209 2.3e-8 PFAM
Pfam:AAA_33 42 199 6.4e-11 PFAM
PGAM 253 342 1.31e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189534
SMART Domains Protein: ENSMUSP00000140355
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-106 PFAM
Pfam:KTI12 41 208 3.7e-8 PFAM
Pfam:AAA_33 42 199 1.1e-10 PFAM
PGAM 253 400 3.82e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191301
SMART Domains Protein: ENSMUSP00000140995
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 181 9.5e-70 PFAM
Pfam:KTI12 41 183 3.2e-8 PFAM
Pfam:AAA_33 42 184 1.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191347
SMART Domains Protein: ENSMUSP00000140698
Gene: ENSMUSG00000026409

DomainStartEndE-ValueType
Pfam:6PF2K 28 251 1.2e-103 PFAM
Pfam:KTI12 41 207 2.4e-5 PFAM
Pfam:AAA_33 42 199 1.6e-8 PFAM
PGAM 253 400 2.9e-20 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein ubiquitination controls many intracellular processes, including cell cycle progression, transcriptional activation, and signal transduction. This dynamic process, involving ubiquitin conjugating enzymes and deubiquitinating enzymes, adds and removes ubiquitin. Deubiquitinating enzymes are cysteine proteases that specifically cleave ubiquitin from ubiquitin-conjugated protein substrates. The protein encoded by this gene belongs to a DUB subfamily characterized by an ovarian tumor (OTU) domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 G A 8: 24,872,630 S17L probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Ankrd34c A G 9: 89,729,328 V320A probably benign Het
Aox2 C A 1: 58,349,068 L1112I possibly damaging Het
Arap2 A C 5: 62,677,100 probably null Het
Atm A T 9: 53,490,282 I1429N probably damaging Het
Ccdc68 A G 18: 69,966,790 N290D probably damaging Het
Chst1 T C 2: 92,613,197 W5R probably damaging Het
Clip1 G T 5: 123,614,764 probably benign Het
Crebbp T C 16: 4,117,500 T842A probably damaging Het
Cyp2b13 T C 7: 26,081,811 probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock1 T A 7: 134,756,793 probably null Het
Dst A G 1: 34,294,483 I4800V probably damaging Het
Efcab7 CAAGTAAAGTAA CAAGTAA 4: 99,877,959 probably null Het
Epb41l2 C T 10: 25,473,092 Q382* probably null Het
Fam83e A G 7: 45,726,646 D261G probably damaging Het
Ifnk T G 4: 35,152,134 S21A possibly damaging Het
Ift122 A G 6: 115,926,243 H1157R probably benign Het
Ighv1-67 T C 12: 115,604,034 K67R possibly damaging Het
Inpp4a C A 1: 37,372,341 A97D probably damaging Het
Insm1 T A 2: 146,223,426 Y387* probably null Het
Irgm1 T C 11: 48,866,101 I294M possibly damaging Het
Isoc2b C T 7: 4,851,062 V104M probably damaging Het
Kif2c A C 4: 117,167,083 S311R probably benign Het
Morn3 G A 5: 123,041,207 A60V probably damaging Het
Oit3 T C 10: 59,438,712 N89D probably damaging Het
Olfr1174-ps T A 2: 88,311,751 Q15L noncoding transcript Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1262 T C 2: 90,002,532 V42A probably benign Het
Olfr293 A T 7: 86,664,085 N141I probably damaging Het
Olfr912 A C 9: 38,581,773 R165S probably damaging Het
Pan2 C A 10: 128,314,512 N708K possibly damaging Het
Parp1 T A 1: 180,598,362 V886E probably damaging Het
Pcdha8 C A 18: 36,994,700 A745E probably benign Het
Pcyox1 C T 6: 86,394,408 probably null Het
Prl2c2 A T 13: 13,002,128 probably null Het
Samd1 T C 8: 83,999,732 S473P possibly damaging Het
Slc26a1 A T 5: 108,671,907 D475E probably damaging Het
Slco1c1 T C 6: 141,547,809 V239A possibly damaging Het
Smo T A 6: 29,736,045 L12Q unknown Homo
Srpk1 C T 17: 28,602,753 R229Q possibly damaging Het
Syn2 T A 6: 115,239,401 F191L probably damaging Het
Syngr2 T C 11: 117,813,435 V182A probably benign Het
Tarbp1 G A 8: 126,447,400 A889V probably benign Het
Tbc1d2b T C 9: 90,226,209 T430A probably benign Het
Tmem217 T A 17: 29,526,510 Y82F probably damaging Het
Ttll9 T A 2: 152,999,300 Y272* probably null Het
Uts2r A G 11: 121,161,207 Y299C probably damaging Het
Vsig8 T A 1: 172,560,576 M37K probably benign Het
Vwf G T 6: 125,639,376 D1218Y unknown Het
Wdr11 T G 7: 129,624,312 M727R probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp113 G T 5: 138,145,346 S214* probably null Het
Zfp438 T A 18: 5,213,780 M393L probably benign Het
Zfp946 G A 17: 22,455,771 C502Y probably benign Het
Other mutations in Yod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Yod1 APN 1 130719133 missense probably damaging 1.00
IGL02321:Yod1 APN 1 130718951 missense probably damaging 1.00
IGL03018:Yod1 APN 1 130718958 missense probably benign 0.08
R1310:Yod1 UTSW 1 130718830 missense probably benign
R5825:Yod1 UTSW 1 130719006 missense probably damaging 1.00
R6115:Yod1 UTSW 1 130719063 missense possibly damaging 0.48
R6367:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6437:Yod1 UTSW 1 130719148 missense probably damaging 1.00
R6489:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6491:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6729:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6731:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6732:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6742:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6743:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R6781:Yod1 UTSW 1 130717538 missense probably damaging 0.96
R7831:Yod1 UTSW 1 130719249 missense probably damaging 0.99
R8058:Yod1 UTSW 1 130719069 nonsense probably null
R8369:Yod1 UTSW 1 130717623 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GGGGCAATCGAGATCTCAATC -3'
(R):5'- GGCTCCCACTCTTATGAATAGATC -3'

Sequencing Primer
(F):5'- GGCAATCGAGATCTCAATCCTGTC -3'
(R):5'- TAGATCACACCTCTCCAAAGTTG -3'
Posted On2018-08-29