Mutagenetix > Incidental Mutations

Incidental Mutation 'R6766:Smo'

531917

Institutional Source

Beutler Lab

Gene Symbol

Smo

Ensembl Gene

ENSMUSG00000001761

Gene Name

smoothened, frizzled class receptor

Synonyms

E130215L21Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6766 (G1)

Quality Score

181.016

Status

Not validated

Chromosome

Chromosomal Location

29735503-29761365 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 29736045 bp

Zygosity

Homozygous

Amino Acid Change

Leucine to Glutamine at position 12 (L12Q)

Ref Sequence

ENSEMBL: ENSMUSP00000001812 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001812]

Predicted Effect

unknown
Transcript: ENSMUST00000001812
AA Change: L12Q

SMART Domains

Protein: ENSMUSP00000001812
Gene: ENSMUSG00000001761
AA Change: L12Q

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
low complexity region	55	66	N/A	INTRINSIC
FRI	73	187	5.48e-49	SMART
Frizzled	224	559	2.82e-148	SMART
low complexity region	641	652	N/A	INTRINSIC
low complexity region	671	684	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.8%
20x: 96.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor that interacts with the patched protein, a receptor for hedgehog proteins. The encoded protein tranduces signals to other proteins after activation by a hedgehog protein/patched protein complex. [provided by RefSeq, Jul 2010]
PHENOTYPE: Both an ENU-induced mutation and a null mutation are midgestation lethal. Observed defects include failure of neural tube closure and heart and gut defects. Conditional knockouts in chondrocytes and dental epithelium result in short long bones and dentalepithelium derivative defects, respectively. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam32	G	A	8: 24,872,630	S17L	probably damaging	Het
Akt3	A	T	1: 177,050,190	Y337*	probably null	Het
Ankrd34c	A	G	9: 89,729,328	V320A	probably benign	Het
Aox2	C	A	1: 58,349,068	L1112I	possibly damaging	Het
Arap2	A	C	5: 62,677,100		probably null	Het
Atm	A	T	9: 53,490,282	I1429N	probably damaging	Het
Ccdc68	A	G	18: 69,966,790	N290D	probably damaging	Het
Chst1	T	C	2: 92,613,197	W5R	probably damaging	Het
Clip1	G	T	5: 123,614,764		probably benign	Het
Crebbp	T	C	16: 4,117,500	T842A	probably damaging	Het
Cyp2b13	T	C	7: 26,081,811		probably null	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dock1	T	A	7: 134,756,793		probably null	Het
Dst	A	G	1: 34,294,483	I4800V	probably damaging	Het
Efcab7	CAAGTAAAGTAA	CAAGTAA	4: 99,877,959		probably null	Het
Epb41l2	C	T	10: 25,473,092	Q382*	probably null	Het
Fam83e	A	G	7: 45,726,646	D261G	probably damaging	Het
Ifnk	T	G	4: 35,152,134	S21A	possibly damaging	Het
Ift122	A	G	6: 115,926,243	H1157R	probably benign	Het
Ighv1-67	T	C	12: 115,604,034	K67R	possibly damaging	Het
Inpp4a	C	A	1: 37,372,341	A97D	probably damaging	Het
Insm1	T	A	2: 146,223,426	Y387*	probably null	Het
Irgm1	T	C	11: 48,866,101	I294M	possibly damaging	Het
Isoc2b	C	T	7: 4,851,062	V104M	probably damaging	Het
Kif2c	A	C	4: 117,167,083	S311R	probably benign	Het
Morn3	G	A	5: 123,041,207	A60V	probably damaging	Het
Oit3	T	C	10: 59,438,712	N89D	probably damaging	Het
Olfr1174-ps	T	A	2: 88,311,751	Q15L	noncoding transcript	Het
Olfr1221	G	T	2: 89,112,296	T72N	possibly damaging	Het
Olfr1262	T	C	2: 90,002,532	V42A	probably benign	Het
Olfr293	A	T	7: 86,664,085	N141I	probably damaging	Het
Olfr912	A	C	9: 38,581,773	R165S	probably damaging	Het
Pan2	C	A	10: 128,314,512	N708K	possibly damaging	Het
Parp1	T	A	1: 180,598,362	V886E	probably damaging	Het
Pcdha8	C	A	18: 36,994,700	A745E	probably benign	Het
Pcyox1	C	T	6: 86,394,408		probably null	Het
Prl2c2	A	T	13: 13,002,128		probably null	Het
Samd1	T	C	8: 83,999,732	S473P	possibly damaging	Het
Slc26a1	A	T	5: 108,671,907	D475E	probably damaging	Het
Slco1c1	T	C	6: 141,547,809	V239A	possibly damaging	Het
Srpk1	C	T	17: 28,602,753	R229Q	possibly damaging	Het
Syn2	T	A	6: 115,239,401	F191L	probably damaging	Het
Syngr2	T	C	11: 117,813,435	V182A	probably benign	Het
Tarbp1	G	A	8: 126,447,400	A889V	probably benign	Het
Tbc1d2b	T	C	9: 90,226,209	T430A	probably benign	Het
Tmem217	T	A	17: 29,526,510	Y82F	probably damaging	Het
Ttll9	T	A	2: 152,999,300	Y272*	probably null	Het
Uts2r	A	G	11: 121,161,207	Y299C	probably damaging	Het
Vsig8	T	A	1: 172,560,576	M37K	probably benign	Het
Vwf	G	T	6: 125,639,376	D1218Y	unknown	Het
Wdr11	T	G	7: 129,624,312	M727R	probably benign	Het
Wwc2	A	G	8: 47,900,791	Y103H	possibly damaging	Het
Yod1	T	A	1: 130,719,271	L295*	probably null	Het
Zfp113	G	T	5: 138,145,346	S214*	probably null	Het
Zfp438	T	A	18: 5,213,780	M393L	probably benign	Het
Zfp946	G	A	17: 22,455,771	C502Y	probably benign	Het

Other mutations in Smo

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Smo	APN	6	29758894	nonsense	probably null
IGL01969:Smo	APN	6	29755172	critical splice acceptor site	probably null
IGL02078:Smo	APN	6	29754708	missense	possibly damaging	0.46
IGL02248:Smo	APN	6	29757292	missense	possibly damaging	0.69
IGL02496:Smo	APN	6	29758481	missense	probably damaging	0.99
IGL03159:Smo	APN	6	29758505	missense	probably benign	0.00
knobby	UTSW	6	29736174	missense	probably benign
R0548:Smo	UTSW	6	29759586	missense	possibly damaging	0.45
R0606:Smo	UTSW	6	29753604	missense	possibly damaging	0.69
R1164:Smo	UTSW	6	29754719	missense	probably benign	0.18
R1438:Smo	UTSW	6	29755483	missense	possibly damaging	0.89
R1900:Smo	UTSW	6	29736056	missense	unknown
R2022:Smo	UTSW	6	29754716	missense	possibly damaging	0.87
R2023:Smo	UTSW	6	29754716	missense	possibly damaging	0.87
R2129:Smo	UTSW	6	29757314	missense	probably damaging	1.00
R4033:Smo	UTSW	6	29759918	missense	probably damaging	0.98
R4795:Smo	UTSW	6	29755574	missense	probably damaging	0.99
R4878:Smo	UTSW	6	29753571	missense	probably benign	0.02
R4920:Smo	UTSW	6	29759594	missense	probably damaging	1.00
R5165:Smo	UTSW	6	29736078	missense	unknown
R5350:Smo	UTSW	6	29754467	missense	probably benign	0.02
R5554:Smo	UTSW	6	29736124	missense	possibly damaging	0.72
R6409:Smo	UTSW	6	29736114	missense	unknown
R6440:Smo	UTSW	6	29756814	missense	possibly damaging	0.93
R6707:Smo	UTSW	6	29736174	missense	probably benign
R7061:Smo	UTSW	6	29760230	missense	probably damaging	1.00
R7147:Smo	UTSW	6	29758449	missense	possibly damaging	0.91
R7491:Smo	UTSW	6	29736120	missense	probably damaging	0.96
R7500:Smo	UTSW	6	29755535	missense	probably benign	0.09
R7735:Smo	UTSW	6	29759852	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGTTTGCAAAGTTGGGAGTCG -3'
(R):5'- ACGTTGTAGCGCAAAGGCTC -3'

Sequencing Primer
(F):5'- TTGGGAGTCGAGGGGCC -3'
(R):5'- AAAGGCTCGCAGTGGGC -3'

Posted On

2018-08-29