Incidental Mutation 'R6766:Smo'
ID531917
Institutional Source Beutler Lab
Gene Symbol Smo
Ensembl Gene ENSMUSG00000001761
Gene Namesmoothened, frizzled class receptor
SynonymsE130215L21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6766 (G1)
Quality Score181.016
Status Not validated
Chromosome6
Chromosomal Location29735503-29761365 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29736045 bp
ZygosityHomozygous
Amino Acid Change Leucine to Glutamine at position 12 (L12Q)
Ref Sequence ENSEMBL: ENSMUSP00000001812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001812]
Predicted Effect unknown
Transcript: ENSMUST00000001812
AA Change: L12Q
SMART Domains Protein: ENSMUSP00000001812
Gene: ENSMUSG00000001761
AA Change: L12Q

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
FRI 73 187 5.48e-49 SMART
Frizzled 224 559 2.82e-148 SMART
low complexity region 641 652 N/A INTRINSIC
low complexity region 671 684 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor that interacts with the patched protein, a receptor for hedgehog proteins. The encoded protein tranduces signals to other proteins after activation by a hedgehog protein/patched protein complex. [provided by RefSeq, Jul 2010]
PHENOTYPE: Both an ENU-induced mutation and a null mutation are midgestation lethal. Observed defects include failure of neural tube closure and heart and gut defects. Conditional knockouts in chondrocytes and dental epithelium result in short long bones and dentalepithelium derivative defects, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 G A 8: 24,872,630 S17L probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Ankrd34c A G 9: 89,729,328 V320A probably benign Het
Aox2 C A 1: 58,349,068 L1112I possibly damaging Het
Arap2 A C 5: 62,677,100 probably null Het
Atm A T 9: 53,490,282 I1429N probably damaging Het
Ccdc68 A G 18: 69,966,790 N290D probably damaging Het
Chst1 T C 2: 92,613,197 W5R probably damaging Het
Clip1 G T 5: 123,614,764 probably benign Het
Crebbp T C 16: 4,117,500 T842A probably damaging Het
Cyp2b13 T C 7: 26,081,811 probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock1 T A 7: 134,756,793 probably null Het
Dst A G 1: 34,294,483 I4800V probably damaging Het
Efcab7 CAAGTAAAGTAA CAAGTAA 4: 99,877,959 probably null Het
Epb41l2 C T 10: 25,473,092 Q382* probably null Het
Fam83e A G 7: 45,726,646 D261G probably damaging Het
Ifnk T G 4: 35,152,134 S21A possibly damaging Het
Ift122 A G 6: 115,926,243 H1157R probably benign Het
Ighv1-67 T C 12: 115,604,034 K67R possibly damaging Het
Inpp4a C A 1: 37,372,341 A97D probably damaging Het
Insm1 T A 2: 146,223,426 Y387* probably null Het
Irgm1 T C 11: 48,866,101 I294M possibly damaging Het
Isoc2b C T 7: 4,851,062 V104M probably damaging Het
Kif2c A C 4: 117,167,083 S311R probably benign Het
Morn3 G A 5: 123,041,207 A60V probably damaging Het
Oit3 T C 10: 59,438,712 N89D probably damaging Het
Olfr1174-ps T A 2: 88,311,751 Q15L noncoding transcript Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1262 T C 2: 90,002,532 V42A probably benign Het
Olfr293 A T 7: 86,664,085 N141I probably damaging Het
Olfr912 A C 9: 38,581,773 R165S probably damaging Het
Pan2 C A 10: 128,314,512 N708K possibly damaging Het
Parp1 T A 1: 180,598,362 V886E probably damaging Het
Pcdha8 C A 18: 36,994,700 A745E probably benign Het
Pcyox1 C T 6: 86,394,408 probably null Het
Prl2c2 A T 13: 13,002,128 probably null Het
Samd1 T C 8: 83,999,732 S473P possibly damaging Het
Slc26a1 A T 5: 108,671,907 D475E probably damaging Het
Slco1c1 T C 6: 141,547,809 V239A possibly damaging Het
Srpk1 C T 17: 28,602,753 R229Q possibly damaging Het
Syn2 T A 6: 115,239,401 F191L probably damaging Het
Syngr2 T C 11: 117,813,435 V182A probably benign Het
Tarbp1 G A 8: 126,447,400 A889V probably benign Het
Tbc1d2b T C 9: 90,226,209 T430A probably benign Het
Tmem217 T A 17: 29,526,510 Y82F probably damaging Het
Ttll9 T A 2: 152,999,300 Y272* probably null Het
Uts2r A G 11: 121,161,207 Y299C probably damaging Het
Vsig8 T A 1: 172,560,576 M37K probably benign Het
Vwf G T 6: 125,639,376 D1218Y unknown Het
Wdr11 T G 7: 129,624,312 M727R probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Yod1 T A 1: 130,719,271 L295* probably null Het
Zfp113 G T 5: 138,145,346 S214* probably null Het
Zfp438 T A 18: 5,213,780 M393L probably benign Het
Zfp946 G A 17: 22,455,771 C502Y probably benign Het
Other mutations in Smo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Smo APN 6 29758894 nonsense probably null
IGL01969:Smo APN 6 29755172 critical splice acceptor site probably null
IGL02078:Smo APN 6 29754708 missense possibly damaging 0.46
IGL02248:Smo APN 6 29757292 missense possibly damaging 0.69
IGL02496:Smo APN 6 29758481 missense probably damaging 0.99
IGL03159:Smo APN 6 29758505 missense probably benign 0.00
knobby UTSW 6 29736174 missense probably benign
R0548:Smo UTSW 6 29759586 missense possibly damaging 0.45
R0606:Smo UTSW 6 29753604 missense possibly damaging 0.69
R1164:Smo UTSW 6 29754719 missense probably benign 0.18
R1438:Smo UTSW 6 29755483 missense possibly damaging 0.89
R1900:Smo UTSW 6 29736056 missense unknown
R2022:Smo UTSW 6 29754716 missense possibly damaging 0.87
R2023:Smo UTSW 6 29754716 missense possibly damaging 0.87
R2129:Smo UTSW 6 29757314 missense probably damaging 1.00
R4033:Smo UTSW 6 29759918 missense probably damaging 0.98
R4795:Smo UTSW 6 29755574 missense probably damaging 0.99
R4878:Smo UTSW 6 29753571 missense probably benign 0.02
R4920:Smo UTSW 6 29759594 missense probably damaging 1.00
R5165:Smo UTSW 6 29736078 missense unknown
R5350:Smo UTSW 6 29754467 missense probably benign 0.02
R5554:Smo UTSW 6 29736124 missense possibly damaging 0.72
R6409:Smo UTSW 6 29736114 missense unknown
R6440:Smo UTSW 6 29756814 missense possibly damaging 0.93
R6707:Smo UTSW 6 29736174 missense probably benign
R7061:Smo UTSW 6 29760230 missense probably damaging 1.00
R7147:Smo UTSW 6 29758449 missense possibly damaging 0.91
R7491:Smo UTSW 6 29736120 missense probably damaging 0.96
R7500:Smo UTSW 6 29755535 missense probably benign 0.09
R7735:Smo UTSW 6 29759852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTTGCAAAGTTGGGAGTCG -3'
(R):5'- ACGTTGTAGCGCAAAGGCTC -3'

Sequencing Primer
(F):5'- TTGGGAGTCGAGGGGCC -3'
(R):5'- AAAGGCTCGCAGTGGGC -3'
Posted On2018-08-29