Incidental Mutation 'R6766:Syn2'
ID531919
Institutional Source Beutler Lab
Gene Symbol Syn2
Ensembl Gene ENSMUSG00000009394
Gene Namesynapsin II
SynonymsSynapsin IIb, 2900074L19Rik, Synapsin IIa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R6766 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location115134902-115282006 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 115239401 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 191 (F191L)
Ref Sequence ENSEMBL: ENSMUSP00000144921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009538] [ENSMUST00000032462] [ENSMUST00000166681] [ENSMUST00000169345] [ENSMUST00000203450]
Predicted Effect probably damaging
Transcript: ENSMUST00000009538
AA Change: F191L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000009538
Gene: ENSMUSG00000009394
AA Change: F191L

DomainStartEndE-ValueType
Pfam:Synapsin_N 2 33 3.4e-24 PFAM
Pfam:Synapsin 112 213 6.4e-48 PFAM
Pfam:Synapsin_C 215 417 8.2e-140 PFAM
low complexity region 450 470 N/A INTRINSIC
low complexity region 473 507 N/A INTRINSIC
low complexity region 524 540 N/A INTRINSIC
low complexity region 551 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032462
SMART Domains Protein: ENSMUSP00000032462
Gene: ENSMUSG00000030317

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
NTR 30 207 1.85e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166681
Predicted Effect probably damaging
Transcript: ENSMUST00000169345
AA Change: F191L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133121
Gene: ENSMUSG00000009394
AA Change: F191L

DomainStartEndE-ValueType
Pfam:Synapsin_N 2 33 1.3e-24 PFAM
Pfam:Synapsin 109 213 1.6e-62 PFAM
Pfam:Synapsin_C 215 417 4.4e-133 PFAM
Pfam:RimK 247 403 4.5e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203450
AA Change: F191L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144921
Gene: ENSMUSG00000009394
AA Change: F191L

DomainStartEndE-ValueType
Pfam:Synapsin_N 2 33 2.7e-24 PFAM
Pfam:Synapsin 112 213 4.6e-48 PFAM
Pfam:Synapsin_C 215 417 5.3e-140 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the synapsin gene family. Synapsins encode neuronal phosphoproteins which associate with the cytoplasmic surface of synaptic vesicles. Family members are characterized by common protein domains, and they are implicated in synaptogenesis and the modulation of neurotransmitter release, suggesting a potential role in several neuropsychiatric diseases. This member of the synapsin family encodes a neuron-specific phosphoprotein that selectively binds to small synaptic vesicles in the presynaptic nerve terminal. Polymorphisms in this gene are associated with abnormal presynaptic function and related neuronal disorders, including autism, epilepsy, bipolar disorder and schizophrenia. Alternative splicing of this gene results in multiple transcript variants. The tissue inhibitor of metalloproteinase 4 gene is located within an intron of this gene and is transcribed in the opposite direction. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in central nervous system abnormalities. One model showed delayed synapse formation and decreased brain weight while another allele showed decreased post-tetanic potentiation and increased synaptic depression and development of convulsive seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 G A 8: 24,872,630 S17L probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Ankrd34c A G 9: 89,729,328 V320A probably benign Het
Aox2 C A 1: 58,349,068 L1112I possibly damaging Het
Arap2 A C 5: 62,677,100 probably null Het
Atm A T 9: 53,490,282 I1429N probably damaging Het
Ccdc68 A G 18: 69,966,790 N290D probably damaging Het
Chst1 T C 2: 92,613,197 W5R probably damaging Het
Clip1 G T 5: 123,614,764 probably benign Het
Crebbp T C 16: 4,117,500 T842A probably damaging Het
Cyp2b13 T C 7: 26,081,811 probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock1 T A 7: 134,756,793 probably null Het
Dst A G 1: 34,294,483 I4800V probably damaging Het
Efcab7 CAAGTAAAGTAA CAAGTAA 4: 99,877,959 probably null Het
Epb41l2 C T 10: 25,473,092 Q382* probably null Het
Fam83e A G 7: 45,726,646 D261G probably damaging Het
Ifnk T G 4: 35,152,134 S21A possibly damaging Het
Ift122 A G 6: 115,926,243 H1157R probably benign Het
Ighv1-67 T C 12: 115,604,034 K67R possibly damaging Het
Inpp4a C A 1: 37,372,341 A97D probably damaging Het
Insm1 T A 2: 146,223,426 Y387* probably null Het
Irgm1 T C 11: 48,866,101 I294M possibly damaging Het
Isoc2b C T 7: 4,851,062 V104M probably damaging Het
Kif2c A C 4: 117,167,083 S311R probably benign Het
Morn3 G A 5: 123,041,207 A60V probably damaging Het
Oit3 T C 10: 59,438,712 N89D probably damaging Het
Olfr1174-ps T A 2: 88,311,751 Q15L noncoding transcript Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1262 T C 2: 90,002,532 V42A probably benign Het
Olfr293 A T 7: 86,664,085 N141I probably damaging Het
Olfr912 A C 9: 38,581,773 R165S probably damaging Het
Pan2 C A 10: 128,314,512 N708K possibly damaging Het
Parp1 T A 1: 180,598,362 V886E probably damaging Het
Pcdha8 C A 18: 36,994,700 A745E probably benign Het
Pcyox1 C T 6: 86,394,408 probably null Het
Prl2c2 A T 13: 13,002,128 probably null Het
Samd1 T C 8: 83,999,732 S473P possibly damaging Het
Slc26a1 A T 5: 108,671,907 D475E probably damaging Het
Slco1c1 T C 6: 141,547,809 V239A possibly damaging Het
Smo T A 6: 29,736,045 L12Q unknown Homo
Srpk1 C T 17: 28,602,753 R229Q possibly damaging Het
Syngr2 T C 11: 117,813,435 V182A probably benign Het
Tarbp1 G A 8: 126,447,400 A889V probably benign Het
Tbc1d2b T C 9: 90,226,209 T430A probably benign Het
Tmem217 T A 17: 29,526,510 Y82F probably damaging Het
Ttll9 T A 2: 152,999,300 Y272* probably null Het
Uts2r A G 11: 121,161,207 Y299C probably damaging Het
Vsig8 T A 1: 172,560,576 M37K probably benign Het
Vwf G T 6: 125,639,376 D1218Y unknown Het
Wdr11 T G 7: 129,624,312 M727R probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Yod1 T A 1: 130,719,271 L295* probably null Het
Zfp113 G T 5: 138,145,346 S214* probably null Het
Zfp438 T A 18: 5,213,780 M393L probably benign Het
Zfp946 G A 17: 22,455,771 C502Y probably benign Het
Other mutations in Syn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03040:Syn2 APN 6 115263965 missense possibly damaging 0.92
IGL03328:Syn2 APN 6 115274260 missense probably damaging 0.97
R0044:Syn2 UTSW 6 115135147 missense unknown
R0267:Syn2 UTSW 6 115254150 unclassified probably benign
R2026:Syn2 UTSW 6 115278251 missense probably benign 0.01
R2290:Syn2 UTSW 6 115274229 missense possibly damaging 0.91
R2900:Syn2 UTSW 6 115237334 missense possibly damaging 0.74
R3949:Syn2 UTSW 6 115227329 unclassified probably null
R3983:Syn2 UTSW 6 115237298 missense probably benign 0.01
R5101:Syn2 UTSW 6 115263899 missense probably damaging 1.00
R5502:Syn2 UTSW 6 115278352 missense possibly damaging 0.96
R6334:Syn2 UTSW 6 115263914 missense possibly damaging 0.92
R6546:Syn2 UTSW 6 115281098 missense probably benign 0.18
R7491:Syn2 UTSW 6 115254654 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCCTCAGGTCTTTGGAAAGTGTAG -3'
(R):5'- CTGACAAGCCTCTCGGATCTTC -3'

Sequencing Primer
(F):5'- ATAGTTCTGGATGGGTACATGC -3'
(R):5'- CTCAGTCCGTGCTACTATTGGAG -3'
Posted On2018-08-29