Incidental Mutation 'R6766:Cyp2b13'
ID531924
Institutional Source Beutler Lab
Gene Symbol Cyp2b13
Ensembl Gene ENSMUSG00000040583
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 13
Synonymsphenobarbital inducible, type c
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6766 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location26061497-26096197 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 26081811 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000005669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005669]
Predicted Effect probably null
Transcript: ENSMUST00000005669
SMART Domains Protein: ENSMUSP00000005669
Gene: ENSMUSG00000040583

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:p450 31 488 9.8e-150 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 G A 8: 24,872,630 S17L probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Ankrd34c A G 9: 89,729,328 V320A probably benign Het
Aox2 C A 1: 58,349,068 L1112I possibly damaging Het
Arap2 A C 5: 62,677,100 probably null Het
Atm A T 9: 53,490,282 I1429N probably damaging Het
Ccdc68 A G 18: 69,966,790 N290D probably damaging Het
Chst1 T C 2: 92,613,197 W5R probably damaging Het
Clip1 G T 5: 123,614,764 probably benign Het
Crebbp T C 16: 4,117,500 T842A probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock1 T A 7: 134,756,793 probably null Het
Dst A G 1: 34,294,483 I4800V probably damaging Het
Efcab7 CAAGTAAAGTAA CAAGTAA 4: 99,877,959 probably null Het
Epb41l2 C T 10: 25,473,092 Q382* probably null Het
Fam83e A G 7: 45,726,646 D261G probably damaging Het
Ifnk T G 4: 35,152,134 S21A possibly damaging Het
Ift122 A G 6: 115,926,243 H1157R probably benign Het
Ighv1-67 T C 12: 115,604,034 K67R possibly damaging Het
Inpp4a C A 1: 37,372,341 A97D probably damaging Het
Insm1 T A 2: 146,223,426 Y387* probably null Het
Irgm1 T C 11: 48,866,101 I294M possibly damaging Het
Isoc2b C T 7: 4,851,062 V104M probably damaging Het
Kif2c A C 4: 117,167,083 S311R probably benign Het
Morn3 G A 5: 123,041,207 A60V probably damaging Het
Oit3 T C 10: 59,438,712 N89D probably damaging Het
Olfr1174-ps T A 2: 88,311,751 Q15L noncoding transcript Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1262 T C 2: 90,002,532 V42A probably benign Het
Olfr293 A T 7: 86,664,085 N141I probably damaging Het
Olfr912 A C 9: 38,581,773 R165S probably damaging Het
Pan2 C A 10: 128,314,512 N708K possibly damaging Het
Parp1 T A 1: 180,598,362 V886E probably damaging Het
Pcdha8 C A 18: 36,994,700 A745E probably benign Het
Pcyox1 C T 6: 86,394,408 probably null Het
Prl2c2 A T 13: 13,002,128 probably null Het
Samd1 T C 8: 83,999,732 S473P possibly damaging Het
Slc26a1 A T 5: 108,671,907 D475E probably damaging Het
Slco1c1 T C 6: 141,547,809 V239A possibly damaging Het
Smo T A 6: 29,736,045 L12Q unknown Homo
Srpk1 C T 17: 28,602,753 R229Q possibly damaging Het
Syn2 T A 6: 115,239,401 F191L probably damaging Het
Syngr2 T C 11: 117,813,435 V182A probably benign Het
Tarbp1 G A 8: 126,447,400 A889V probably benign Het
Tbc1d2b T C 9: 90,226,209 T430A probably benign Het
Tmem217 T A 17: 29,526,510 Y82F probably damaging Het
Ttll9 T A 2: 152,999,300 Y272* probably null Het
Uts2r A G 11: 121,161,207 Y299C probably damaging Het
Vsig8 T A 1: 172,560,576 M37K probably benign Het
Vwf G T 6: 125,639,376 D1218Y unknown Het
Wdr11 T G 7: 129,624,312 M727R probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Yod1 T A 1: 130,719,271 L295* probably null Het
Zfp113 G T 5: 138,145,346 S214* probably null Het
Zfp438 T A 18: 5,213,780 M393L probably benign Het
Zfp946 G A 17: 22,455,771 C502Y probably benign Het
Other mutations in Cyp2b13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00980:Cyp2b13 APN 7 26081727 missense probably benign 0.26
IGL01134:Cyp2b13 APN 7 26081700 missense probably damaging 1.00
IGL02386:Cyp2b13 APN 7 26086013 missense probably damaging 1.00
IGL02531:Cyp2b13 APN 7 26061605 missense possibly damaging 0.55
IGL02960:Cyp2b13 APN 7 26061676 missense probably benign 0.33
R0018:Cyp2b13 UTSW 7 26085950 missense probably benign 0.30
R0018:Cyp2b13 UTSW 7 26085950 missense probably benign 0.30
R0103:Cyp2b13 UTSW 7 26088710 missense probably damaging 1.00
R0121:Cyp2b13 UTSW 7 26086585 missense probably benign
R0392:Cyp2b13 UTSW 7 26085883 missense probably benign 0.01
R0540:Cyp2b13 UTSW 7 26081711 missense probably benign 0.07
R1887:Cyp2b13 UTSW 7 26088650 missense probably damaging 1.00
R2416:Cyp2b13 UTSW 7 26095821 makesense probably null
R2879:Cyp2b13 UTSW 7 26086031 critical splice donor site probably null
R4654:Cyp2b13 UTSW 7 26061647 missense probably damaging 1.00
R4735:Cyp2b13 UTSW 7 26088295 missense probably benign
R4969:Cyp2b13 UTSW 7 26080988 missense probably damaging 0.98
R5174:Cyp2b13 UTSW 7 26088693 missense possibly damaging 0.68
R6243:Cyp2b13 UTSW 7 26061619 missense probably damaging 1.00
R6616:Cyp2b13 UTSW 7 26085881 missense probably benign 0.04
R6647:Cyp2b13 UTSW 7 26085899 missense possibly damaging 0.52
R6844:Cyp2b13 UTSW 7 26081697 missense probably damaging 1.00
R7431:Cyp2b13 UTSW 7 26061551 missense probably damaging 0.96
R7593:Cyp2b13 UTSW 7 26080991 missense possibly damaging 0.64
R7719:Cyp2b13 UTSW 7 26095670 missense probably damaging 1.00
R7857:Cyp2b13 UTSW 7 26088728 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AAGGGGTAGCCTTTCAGGTG -3'
(R):5'- TGTCTGGCTATACCCACACC -3'

Sequencing Primer
(F):5'- GCTGATGCCAAATCTTCTCCATG -3'
(R):5'- ATGACTCTGTATTTCCACATTCAGG -3'
Posted On2018-08-29