Incidental Mutation 'R6766:Fam83e'
ID531925
Institutional Source Beutler Lab
Gene Symbol Fam83e
Ensembl Gene ENSMUSG00000054161
Gene Namefamily with sequence similarity 83, member E
Synonyms4930403C10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6766 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location45721212-45729492 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45726646 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 261 (D261G)
Ref Sequence ENSEMBL: ENSMUSP00000114397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075571] [ENSMUST00000094424] [ENSMUST00000129507] [ENSMUST00000209739] [ENSMUST00000210754]
Predicted Effect probably benign
Transcript: ENSMUST00000075571
SMART Domains Protein: ENSMUSP00000075005
Gene: ENSMUSG00000003271

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 57 302 7.8e-84 PFAM
low complexity region 309 337 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094424
SMART Domains Protein: ENSMUSP00000091991
Gene: ENSMUSG00000070563

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:UPAR_LY6 23 97 1.7e-7 PFAM
low complexity region 99 123 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129507
AA Change: D261G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114397
Gene: ENSMUSG00000054161
AA Change: D261G

DomainStartEndE-ValueType
Pfam:DUF1669 18 293 4.8e-105 PFAM
low complexity region 371 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209739
Predicted Effect probably benign
Transcript: ENSMUST00000210754
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 G A 8: 24,872,630 S17L probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Ankrd34c A G 9: 89,729,328 V320A probably benign Het
Aox2 C A 1: 58,349,068 L1112I possibly damaging Het
Arap2 A C 5: 62,677,100 probably null Het
Atm A T 9: 53,490,282 I1429N probably damaging Het
Ccdc68 A G 18: 69,966,790 N290D probably damaging Het
Chst1 T C 2: 92,613,197 W5R probably damaging Het
Clip1 G T 5: 123,614,764 probably benign Het
Crebbp T C 16: 4,117,500 T842A probably damaging Het
Cyp2b13 T C 7: 26,081,811 probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock1 T A 7: 134,756,793 probably null Het
Dst A G 1: 34,294,483 I4800V probably damaging Het
Efcab7 CAAGTAAAGTAA CAAGTAA 4: 99,877,959 probably null Het
Epb41l2 C T 10: 25,473,092 Q382* probably null Het
Ifnk T G 4: 35,152,134 S21A possibly damaging Het
Ift122 A G 6: 115,926,243 H1157R probably benign Het
Ighv1-67 T C 12: 115,604,034 K67R possibly damaging Het
Inpp4a C A 1: 37,372,341 A97D probably damaging Het
Insm1 T A 2: 146,223,426 Y387* probably null Het
Irgm1 T C 11: 48,866,101 I294M possibly damaging Het
Isoc2b C T 7: 4,851,062 V104M probably damaging Het
Kif2c A C 4: 117,167,083 S311R probably benign Het
Morn3 G A 5: 123,041,207 A60V probably damaging Het
Oit3 T C 10: 59,438,712 N89D probably damaging Het
Olfr1174-ps T A 2: 88,311,751 Q15L noncoding transcript Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1262 T C 2: 90,002,532 V42A probably benign Het
Olfr293 A T 7: 86,664,085 N141I probably damaging Het
Olfr912 A C 9: 38,581,773 R165S probably damaging Het
Pan2 C A 10: 128,314,512 N708K possibly damaging Het
Parp1 T A 1: 180,598,362 V886E probably damaging Het
Pcdha8 C A 18: 36,994,700 A745E probably benign Het
Pcyox1 C T 6: 86,394,408 probably null Het
Prl2c2 A T 13: 13,002,128 probably null Het
Samd1 T C 8: 83,999,732 S473P possibly damaging Het
Slc26a1 A T 5: 108,671,907 D475E probably damaging Het
Slco1c1 T C 6: 141,547,809 V239A possibly damaging Het
Smo T A 6: 29,736,045 L12Q unknown Homo
Srpk1 C T 17: 28,602,753 R229Q possibly damaging Het
Syn2 T A 6: 115,239,401 F191L probably damaging Het
Syngr2 T C 11: 117,813,435 V182A probably benign Het
Tarbp1 G A 8: 126,447,400 A889V probably benign Het
Tbc1d2b T C 9: 90,226,209 T430A probably benign Het
Tmem217 T A 17: 29,526,510 Y82F probably damaging Het
Ttll9 T A 2: 152,999,300 Y272* probably null Het
Uts2r A G 11: 121,161,207 Y299C probably damaging Het
Vsig8 T A 1: 172,560,576 M37K probably benign Het
Vwf G T 6: 125,639,376 D1218Y unknown Het
Wdr11 T G 7: 129,624,312 M727R probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Yod1 T A 1: 130,719,271 L295* probably null Het
Zfp113 G T 5: 138,145,346 S214* probably null Het
Zfp438 T A 18: 5,213,780 M393L probably benign Het
Zfp946 G A 17: 22,455,771 C502Y probably benign Het
Other mutations in Fam83e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Fam83e APN 7 45727069 missense probably benign 0.12
IGL01590:Fam83e APN 7 45723936 missense probably null 1.00
IGL02334:Fam83e APN 7 45723921 missense probably benign 0.00
IGL03155:Fam83e APN 7 45727075 missense possibly damaging 0.90
IGL03276:Fam83e APN 7 45723460 missense possibly damaging 0.72
R0268:Fam83e UTSW 7 45726910 missense probably benign
R0362:Fam83e UTSW 7 45726969 missense probably benign 0.40
R0453:Fam83e UTSW 7 45723948 missense probably damaging 1.00
R0832:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R0870:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R0871:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R1415:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R1574:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R1574:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R1656:Fam83e UTSW 7 45722263 missense probably benign
R1848:Fam83e UTSW 7 45728769 nonsense probably null
R1848:Fam83e UTSW 7 45728770 missense possibly damaging 0.79
R2189:Fam83e UTSW 7 45722183 start codon destroyed probably null 0.88
R2256:Fam83e UTSW 7 45728769 nonsense probably null
R2256:Fam83e UTSW 7 45728770 missense possibly damaging 0.79
R2257:Fam83e UTSW 7 45728769 nonsense probably null
R2257:Fam83e UTSW 7 45728770 missense possibly damaging 0.79
R4376:Fam83e UTSW 7 45723893 missense probably damaging 1.00
R4600:Fam83e UTSW 7 45723500 missense probably benign 0.01
R5876:Fam83e UTSW 7 45722363 splice site probably null
R6666:Fam83e UTSW 7 45727002 missense probably benign
R6781:Fam83e UTSW 7 45722147 unclassified probably benign
R6933:Fam83e UTSW 7 45722394 missense probably benign
R7320:Fam83e UTSW 7 45722472 missense probably benign 0.16
R7477:Fam83e UTSW 7 45728980 missense probably damaging 1.00
R7636:Fam83e UTSW 7 45727026 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGTCATCTAACTTTAGGTAGTC -3'
(R):5'- TCAGACAGCAATGGGGCTAC -3'

Sequencing Primer
(F):5'- AGATAGTCTCATGTAGCCTAGGC -3'
(R):5'- TACAGGGGCCACAGGAC -3'
Posted On2018-08-29