Incidental Mutation 'R6766:Epb41l2'
ID531937
Institutional Source Beutler Lab
Gene Symbol Epb41l2
Ensembl Gene ENSMUSG00000019978
Gene Nameerythrocyte membrane protein band 4.1 like 2
SynonymsNBL2, 4.1G, Epb4.1l2, D10Ertd398e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R6766 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location25359798-25523519 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 25473092 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 382 (Q382*)
Ref Sequence ENSEMBL: ENSMUSP00000151332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053748] [ENSMUST00000092645] [ENSMUST00000217929] [ENSMUST00000218903] [ENSMUST00000219805] [ENSMUST00000219900]
Predicted Effect probably null
Transcript: ENSMUST00000053748
AA Change: Q382*
SMART Domains Protein: ENSMUSP00000055122
Gene: ENSMUSG00000019978
AA Change: Q382*

DomainStartEndE-ValueType
B41 207 402 3.22e-76 SMART
FERM_C 406 496 2.15e-39 SMART
FA 499 545 1.93e-18 SMART
low complexity region 555 567 N/A INTRINSIC
Pfam:SAB 613 661 1.8e-23 PFAM
low complexity region 717 733 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
Pfam:4_1_CTD 875 981 1.1e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000092645
AA Change: Q382*
SMART Domains Protein: ENSMUSP00000090314
Gene: ENSMUSG00000019978
AA Change: Q382*

DomainStartEndE-ValueType
B41 207 402 3.22e-76 SMART
FERM_C 406 496 2.15e-39 SMART
FA 499 545 1.93e-18 SMART
low complexity region 555 567 N/A INTRINSIC
Pfam:SAB 613 661 6.1e-27 PFAM
low complexity region 717 733 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
Pfam:4_1_CTD 869 982 8.2e-59 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217929
AA Change: Q382*
Predicted Effect probably null
Transcript: ENSMUST00000218903
AA Change: Q382*
Predicted Effect probably null
Transcript: ENSMUST00000219805
AA Change: Q382*
Predicted Effect probably null
Transcript: ENSMUST00000219900
AA Change: Q382*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal glutamatergic synapse formation, AMPAR responses and long-term potentiation. Male mice homozygous for a knock-out allele exhibit normal fertility. Male mice homozygous for a gene trap allele on a mixed background are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 G A 8: 24,872,630 S17L probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Ankrd34c A G 9: 89,729,328 V320A probably benign Het
Aox2 C A 1: 58,349,068 L1112I possibly damaging Het
Arap2 A C 5: 62,677,100 probably null Het
Atm A T 9: 53,490,282 I1429N probably damaging Het
Ccdc68 A G 18: 69,966,790 N290D probably damaging Het
Chst1 T C 2: 92,613,197 W5R probably damaging Het
Clip1 G T 5: 123,614,764 probably benign Het
Crebbp T C 16: 4,117,500 T842A probably damaging Het
Cyp2b13 T C 7: 26,081,811 probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock1 T A 7: 134,756,793 probably null Het
Dst A G 1: 34,294,483 I4800V probably damaging Het
Efcab7 CAAGTAAAGTAA CAAGTAA 4: 99,877,959 probably null Het
Fam83e A G 7: 45,726,646 D261G probably damaging Het
Ifnk T G 4: 35,152,134 S21A possibly damaging Het
Ift122 A G 6: 115,926,243 H1157R probably benign Het
Ighv1-67 T C 12: 115,604,034 K67R possibly damaging Het
Inpp4a C A 1: 37,372,341 A97D probably damaging Het
Insm1 T A 2: 146,223,426 Y387* probably null Het
Irgm1 T C 11: 48,866,101 I294M possibly damaging Het
Isoc2b C T 7: 4,851,062 V104M probably damaging Het
Kif2c A C 4: 117,167,083 S311R probably benign Het
Morn3 G A 5: 123,041,207 A60V probably damaging Het
Oit3 T C 10: 59,438,712 N89D probably damaging Het
Olfr1174-ps T A 2: 88,311,751 Q15L noncoding transcript Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1262 T C 2: 90,002,532 V42A probably benign Het
Olfr293 A T 7: 86,664,085 N141I probably damaging Het
Olfr912 A C 9: 38,581,773 R165S probably damaging Het
Pan2 C A 10: 128,314,512 N708K possibly damaging Het
Parp1 T A 1: 180,598,362 V886E probably damaging Het
Pcdha8 C A 18: 36,994,700 A745E probably benign Het
Pcyox1 C T 6: 86,394,408 probably null Het
Prl2c2 A T 13: 13,002,128 probably null Het
Samd1 T C 8: 83,999,732 S473P possibly damaging Het
Slc26a1 A T 5: 108,671,907 D475E probably damaging Het
Slco1c1 T C 6: 141,547,809 V239A possibly damaging Het
Smo T A 6: 29,736,045 L12Q unknown Homo
Srpk1 C T 17: 28,602,753 R229Q possibly damaging Het
Syn2 T A 6: 115,239,401 F191L probably damaging Het
Syngr2 T C 11: 117,813,435 V182A probably benign Het
Tarbp1 G A 8: 126,447,400 A889V probably benign Het
Tbc1d2b T C 9: 90,226,209 T430A probably benign Het
Tmem217 T A 17: 29,526,510 Y82F probably damaging Het
Ttll9 T A 2: 152,999,300 Y272* probably null Het
Uts2r A G 11: 121,161,207 Y299C probably damaging Het
Vsig8 T A 1: 172,560,576 M37K probably benign Het
Vwf G T 6: 125,639,376 D1218Y unknown Het
Wdr11 T G 7: 129,624,312 M727R probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Yod1 T A 1: 130,719,271 L295* probably null Het
Zfp113 G T 5: 138,145,346 S214* probably null Het
Zfp438 T A 18: 5,213,780 M393L probably benign Het
Zfp946 G A 17: 22,455,771 C502Y probably benign Het
Other mutations in Epb41l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Epb41l2 APN 10 25501836 missense probably damaging 1.00
IGL00826:Epb41l2 APN 10 25441722 missense probably benign 0.07
IGL01312:Epb41l2 APN 10 25441587 start codon destroyed probably null 1.00
IGL02123:Epb41l2 APN 10 25460844 missense probably damaging 1.00
IGL02448:Epb41l2 APN 10 25493595 missense possibly damaging 0.66
R0365:Epb41l2 UTSW 10 25469221 missense probably damaging 1.00
R0594:Epb41l2 UTSW 10 25443770 missense possibly damaging 0.53
R0826:Epb41l2 UTSW 10 25504192 missense probably damaging 1.00
R0837:Epb41l2 UTSW 10 25507816 missense probably damaging 1.00
R1243:Epb41l2 UTSW 10 25489043 missense possibly damaging 0.81
R1301:Epb41l2 UTSW 10 25443902 missense probably damaging 1.00
R1560:Epb41l2 UTSW 10 25495436 splice site probably null
R1752:Epb41l2 UTSW 10 25460792 missense probably damaging 1.00
R1813:Epb41l2 UTSW 10 25441568 splice site probably null
R1966:Epb41l2 UTSW 10 25441768 missense probably benign 0.01
R2276:Epb41l2 UTSW 10 25488944 unclassified probably benign
R4425:Epb41l2 UTSW 10 25506180 missense possibly damaging 0.81
R4445:Epb41l2 UTSW 10 25443803 missense possibly damaging 0.92
R4621:Epb41l2 UTSW 10 25502140 critical splice donor site probably null
R4720:Epb41l2 UTSW 10 25471626 missense probably damaging 1.00
R5026:Epb41l2 UTSW 10 25484308 missense possibly damaging 0.94
R5408:Epb41l2 UTSW 10 25468094 critical splice acceptor site probably null
R5703:Epb41l2 UTSW 10 25441767 missense probably damaging 1.00
R5896:Epb41l2 UTSW 10 25493596 missense probably damaging 0.96
R5974:Epb41l2 UTSW 10 25441815 missense possibly damaging 0.79
R6073:Epb41l2 UTSW 10 25501832 missense probably damaging 1.00
R6182:Epb41l2 UTSW 10 25507817 missense probably damaging 1.00
R6229:Epb41l2 UTSW 10 25499836 missense possibly damaging 0.73
R6276:Epb41l2 UTSW 10 25502124 missense probably damaging 0.98
R6321:Epb41l2 UTSW 10 25468128 missense probably damaging 0.98
R6737:Epb41l2 UTSW 10 25489018 splice site probably null
R6834:Epb41l2 UTSW 10 25493604 missense possibly damaging 0.92
R7023:Epb41l2 UTSW 10 25512977 missense probably damaging 1.00
R7258:Epb41l2 UTSW 10 25484287 missense probably damaging 1.00
R7688:Epb41l2 UTSW 10 25479138 missense probably damaging 0.97
R7769:Epb41l2 UTSW 10 25493573 missense probably benign
R7796:Epb41l2 UTSW 10 25443829 missense probably benign 0.15
R8365:Epb41l2 UTSW 10 25441686 missense probably benign 0.21
Z1176:Epb41l2 UTSW 10 25441720 missense probably benign 0.03
Z1176:Epb41l2 UTSW 10 25499902 nonsense probably null
Z1177:Epb41l2 UTSW 10 25479741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAACTGTCTTTGGTAGCC -3'
(R):5'- CCAAGAAATATTGCAGACCAAAGTG -3'

Sequencing Primer
(F):5'- ACAGAACTGTCTTTGGTAGCCCTTAC -3'
(R):5'- TCAGTCACCAAGCTGGAA -3'
Posted On2018-08-29