Incidental Mutation 'R6766:Oit3'
ID 531938
Institutional Source Beutler Lab
Gene Symbol Oit3
Ensembl Gene ENSMUSG00000009654
Gene Name oncoprotein induced transcript 3
Synonyms EF-9
MMRRC Submission 044882-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.420) question?
Stock # R6766 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 59258782-59277601 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59274534 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 89 (N89D)
Ref Sequence ENSEMBL: ENSMUSP00000009798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009798]
AlphaFold Q8R4V5
Predicted Effect probably damaging
Transcript: ENSMUST00000009798
AA Change: N89D

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000009798
Gene: ENSMUSG00000009654
AA Change: N89D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:ZP 50 144 9e-24 BLAST
EGF 150 181 2.16e1 SMART
EGF 185 222 2.94e-3 SMART
EGF 226 263 2.35e-2 SMART
ZP 267 516 2.74e-30 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified due to its downregulation in hepatocarcinomas. The encoded protein may be involved in liver development and function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bloord uric acid, increased urine uric acid and polyuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 G A 8: 25,362,646 (GRCm39) S17L probably damaging Het
Akt3 A T 1: 176,877,756 (GRCm39) Y337* probably null Het
Ankrd34c A G 9: 89,611,381 (GRCm39) V320A probably benign Het
Aox1 C A 1: 58,388,227 (GRCm39) L1112I possibly damaging Het
Arap2 A C 5: 62,834,443 (GRCm39) probably null Het
Atm A T 9: 53,401,582 (GRCm39) I1429N probably damaging Het
Ccdc68 A G 18: 70,099,861 (GRCm39) N290D probably damaging Het
Chst1 T C 2: 92,443,542 (GRCm39) W5R probably damaging Het
Clip1 G T 5: 123,752,827 (GRCm39) probably benign Het
Crebbp T C 16: 3,935,364 (GRCm39) T842A probably damaging Het
Cyp2b13 T C 7: 25,781,236 (GRCm39) probably null Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Dock1 T A 7: 134,358,522 (GRCm39) probably null Het
Dst A G 1: 34,333,564 (GRCm39) I4800V probably damaging Het
Efcab7 CAAGTAAAGTAA CAAGTAA 4: 99,735,161 (GRCm39) probably null Het
Epb41l2 C T 10: 25,348,990 (GRCm39) Q382* probably null Het
Fam83e A G 7: 45,376,070 (GRCm39) D261G probably damaging Het
Ifnk T G 4: 35,152,134 (GRCm39) S21A possibly damaging Het
Ift122 A G 6: 115,903,204 (GRCm39) H1157R probably benign Het
Ighv1-67 T C 12: 115,567,654 (GRCm39) K67R possibly damaging Het
Inpp4a C A 1: 37,411,422 (GRCm39) A97D probably damaging Het
Insm1 T A 2: 146,065,346 (GRCm39) Y387* probably null Het
Irgm1 T C 11: 48,756,928 (GRCm39) I294M possibly damaging Het
Isoc2b C T 7: 4,854,061 (GRCm39) V104M probably damaging Het
Kif2c A C 4: 117,024,280 (GRCm39) S311R probably benign Het
Morn3 G A 5: 123,179,270 (GRCm39) A60V probably damaging Het
Or14c40 A T 7: 86,313,293 (GRCm39) N141I probably damaging Het
Or4c116 G T 2: 88,942,640 (GRCm39) T72N possibly damaging Het
Or4c127 T C 2: 89,832,876 (GRCm39) V42A probably benign Het
Or5d44 T A 2: 88,142,095 (GRCm39) Q15L noncoding transcript Het
Or8b48 A C 9: 38,493,069 (GRCm39) R165S probably damaging Het
Pan2 C A 10: 128,150,381 (GRCm39) N708K possibly damaging Het
Parp1 T A 1: 180,425,927 (GRCm39) V886E probably damaging Het
Pcdha8 C A 18: 37,127,753 (GRCm39) A745E probably benign Het
Pcyox1 C T 6: 86,371,390 (GRCm39) probably null Het
Prl2c2 A T 13: 13,176,713 (GRCm39) probably null Het
Samd1 T C 8: 84,726,361 (GRCm39) S473P possibly damaging Het
Slc26a1 A T 5: 108,819,773 (GRCm39) D475E probably damaging Het
Slco1c1 T C 6: 141,493,535 (GRCm39) V239A possibly damaging Het
Smo T A 6: 29,736,044 (GRCm39) L12Q unknown Homo
Srpk1 C T 17: 28,821,727 (GRCm39) R229Q possibly damaging Het
Syn2 T A 6: 115,216,362 (GRCm39) F191L probably damaging Het
Syngr2 T C 11: 117,704,261 (GRCm39) V182A probably benign Het
Tarbp1 G A 8: 127,174,139 (GRCm39) A889V probably benign Het
Tbc1d2b T C 9: 90,108,262 (GRCm39) T430A probably benign Het
Tmem217 T A 17: 29,745,484 (GRCm39) Y82F probably damaging Het
Ttll9 T A 2: 152,841,220 (GRCm39) Y272* probably null Het
Uts2r A G 11: 121,052,033 (GRCm39) Y299C probably damaging Het
Vsig8 T A 1: 172,388,143 (GRCm39) M37K probably benign Het
Vwf G T 6: 125,616,339 (GRCm39) D1218Y unknown Het
Wdr11 T G 7: 129,226,036 (GRCm39) M727R probably benign Het
Wwc2 A G 8: 48,353,826 (GRCm39) Y103H possibly damaging Het
Yod1 T A 1: 130,647,008 (GRCm39) L295* probably null Het
Zfp113 G T 5: 138,143,608 (GRCm39) S214* probably null Het
Zfp438 T A 18: 5,213,780 (GRCm39) M393L probably benign Het
Zfp946 G A 17: 22,674,752 (GRCm39) C502Y probably benign Het
Other mutations in Oit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Oit3 APN 10 59,261,306 (GRCm39) unclassified probably benign
IGL01665:Oit3 APN 10 59,274,731 (GRCm39) missense probably damaging 1.00
IGL01839:Oit3 APN 10 59,265,318 (GRCm39) missense probably damaging 0.98
IGL02028:Oit3 APN 10 59,274,477 (GRCm39) missense probably damaging 0.98
PIT4585001:Oit3 UTSW 10 59,266,835 (GRCm39) missense possibly damaging 0.54
R0567:Oit3 UTSW 10 59,271,800 (GRCm39) missense probably damaging 0.99
R0781:Oit3 UTSW 10 59,264,016 (GRCm39) missense probably damaging 1.00
R1110:Oit3 UTSW 10 59,264,016 (GRCm39) missense probably damaging 1.00
R1563:Oit3 UTSW 10 59,263,896 (GRCm39) missense probably damaging 1.00
R1623:Oit3 UTSW 10 59,264,061 (GRCm39) missense probably damaging 0.99
R1693:Oit3 UTSW 10 59,261,239 (GRCm39) missense probably damaging 1.00
R1754:Oit3 UTSW 10 59,263,762 (GRCm39) splice site probably null
R1853:Oit3 UTSW 10 59,277,444 (GRCm39) critical splice donor site probably null
R2070:Oit3 UTSW 10 59,266,835 (GRCm39) missense probably benign 0.03
R2211:Oit3 UTSW 10 59,263,892 (GRCm39) missense probably damaging 1.00
R2516:Oit3 UTSW 10 59,277,507 (GRCm39) start gained probably benign
R2516:Oit3 UTSW 10 59,264,167 (GRCm39) missense probably damaging 1.00
R3103:Oit3 UTSW 10 59,274,713 (GRCm39) missense probably damaging 0.98
R4414:Oit3 UTSW 10 59,263,925 (GRCm39) missense probably damaging 1.00
R4415:Oit3 UTSW 10 59,263,925 (GRCm39) missense probably damaging 1.00
R4416:Oit3 UTSW 10 59,263,925 (GRCm39) missense probably damaging 1.00
R4417:Oit3 UTSW 10 59,263,925 (GRCm39) missense probably damaging 1.00
R4584:Oit3 UTSW 10 59,261,284 (GRCm39) missense probably damaging 1.00
R4734:Oit3 UTSW 10 59,259,904 (GRCm39) missense probably damaging 0.99
R4748:Oit3 UTSW 10 59,259,904 (GRCm39) missense probably damaging 0.99
R4749:Oit3 UTSW 10 59,259,904 (GRCm39) missense probably damaging 0.99
R5070:Oit3 UTSW 10 59,259,849 (GRCm39) missense probably damaging 1.00
R5521:Oit3 UTSW 10 59,271,736 (GRCm39) missense probably benign
R6326:Oit3 UTSW 10 59,264,061 (GRCm39) missense probably damaging 1.00
R6490:Oit3 UTSW 10 59,274,374 (GRCm39) missense possibly damaging 0.92
R6526:Oit3 UTSW 10 59,265,462 (GRCm39) missense probably damaging 1.00
R6921:Oit3 UTSW 10 59,271,767 (GRCm39) missense probably damaging 0.99
R7129:Oit3 UTSW 10 59,264,166 (GRCm39) missense probably damaging 0.99
R7440:Oit3 UTSW 10 59,265,392 (GRCm39) missense probably damaging 0.99
R7495:Oit3 UTSW 10 59,259,765 (GRCm39) missense possibly damaging 0.74
R7512:Oit3 UTSW 10 59,274,716 (GRCm39) missense probably damaging 1.00
R7866:Oit3 UTSW 10 59,259,852 (GRCm39) missense probably benign 0.03
R8312:Oit3 UTSW 10 59,274,632 (GRCm39) missense probably benign 0.01
R8321:Oit3 UTSW 10 59,263,982 (GRCm39) missense probably benign 0.00
R8919:Oit3 UTSW 10 59,277,468 (GRCm39) missense unknown
R9131:Oit3 UTSW 10 59,271,751 (GRCm39) missense probably benign 0.01
R9457:Oit3 UTSW 10 59,277,505 (GRCm39) start codon destroyed unknown
R9478:Oit3 UTSW 10 59,274,464 (GRCm39) missense probably damaging 0.99
R9502:Oit3 UTSW 10 59,264,173 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACTCCATCTGTGGGCTTG -3'
(R):5'- ATCAGTCTGAACGAGCCCTG -3'

Sequencing Primer
(F):5'- GGGTACTTACGGCCACAGTAGAC -3'
(R):5'- AGCCCTGGAGGAACACTGAC -3'
Posted On 2018-08-29