Mutagenetix > Incidental Mutations

Incidental Mutation 'R6766:Oit3'

531938

Institutional Source

Beutler Lab

Gene Symbol

Oit3

Ensembl Gene

ENSMUSG00000009654

Gene Name

oncoprotein induced transcript 3

Synonyms

EF-9

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.413) question?

Stock #

R6766 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

59422958-59441778 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 59438712 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 89 (N89D)

Ref Sequence

ENSEMBL: ENSMUSP00000009798 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009798]

Predicted Effect

probably damaging
Transcript: ENSMUST00000009798
AA Change: N89D

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000009798
Gene: ENSMUSG00000009654
AA Change: N89D

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:ZP	50	144	9e-24	BLAST
EGF	150	181	2.16e1	SMART
EGF	185	222	2.94e-3	SMART
EGF	226	263	2.35e-2	SMART
ZP	267	516	2.74e-30	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 98.8%
20x: 96.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified due to its downregulation in hepatocarcinomas. The encoded protein may be involved in liver development and function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bloord uric acid, increased urine uric acid and polyuria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam32	G	A	8: 24,872,630	S17L	probably damaging	Het
Akt3	A	T	1: 177,050,190	Y337*	probably null	Het
Ankrd34c	A	G	9: 89,729,328	V320A	probably benign	Het
Aox2	C	A	1: 58,349,068	L1112I	possibly damaging	Het
Arap2	A	C	5: 62,677,100		probably null	Het
Atm	A	T	9: 53,490,282	I1429N	probably damaging	Het
Ccdc68	A	G	18: 69,966,790	N290D	probably damaging	Het
Chst1	T	C	2: 92,613,197	W5R	probably damaging	Het
Clip1	G	T	5: 123,614,764		probably benign	Het
Crebbp	T	C	16: 4,117,500	T842A	probably damaging	Het
Cyp2b13	T	C	7: 26,081,811		probably null	Het
Dnah8	G	A	17: 30,748,568	D2585N	probably benign	Het
Dock1	T	A	7: 134,756,793		probably null	Het
Dst	A	G	1: 34,294,483	I4800V	probably damaging	Het
Efcab7	CAAGTAAAGTAA	CAAGTAA	4: 99,877,959		probably null	Het
Epb41l2	C	T	10: 25,473,092	Q382*	probably null	Het
Fam83e	A	G	7: 45,726,646	D261G	probably damaging	Het
Ifnk	T	G	4: 35,152,134	S21A	possibly damaging	Het
Ift122	A	G	6: 115,926,243	H1157R	probably benign	Het
Ighv1-67	T	C	12: 115,604,034	K67R	possibly damaging	Het
Inpp4a	C	A	1: 37,372,341	A97D	probably damaging	Het
Insm1	T	A	2: 146,223,426	Y387*	probably null	Het
Irgm1	T	C	11: 48,866,101	I294M	possibly damaging	Het
Isoc2b	C	T	7: 4,851,062	V104M	probably damaging	Het
Kif2c	A	C	4: 117,167,083	S311R	probably benign	Het
Morn3	G	A	5: 123,041,207	A60V	probably damaging	Het
Olfr1174-ps	T	A	2: 88,311,751	Q15L	noncoding transcript	Het
Olfr1221	G	T	2: 89,112,296	T72N	possibly damaging	Het
Olfr1262	T	C	2: 90,002,532	V42A	probably benign	Het
Olfr293	A	T	7: 86,664,085	N141I	probably damaging	Het
Olfr912	A	C	9: 38,581,773	R165S	probably damaging	Het
Pan2	C	A	10: 128,314,512	N708K	possibly damaging	Het
Parp1	T	A	1: 180,598,362	V886E	probably damaging	Het
Pcdha8	C	A	18: 36,994,700	A745E	probably benign	Het
Pcyox1	C	T	6: 86,394,408		probably null	Het
Prl2c2	A	T	13: 13,002,128		probably null	Het
Samd1	T	C	8: 83,999,732	S473P	possibly damaging	Het
Slc26a1	A	T	5: 108,671,907	D475E	probably damaging	Het
Slco1c1	T	C	6: 141,547,809	V239A	possibly damaging	Het
Smo	T	A	6: 29,736,045	L12Q	unknown	Homo
Srpk1	C	T	17: 28,602,753	R229Q	possibly damaging	Het
Syn2	T	A	6: 115,239,401	F191L	probably damaging	Het
Syngr2	T	C	11: 117,813,435	V182A	probably benign	Het
Tarbp1	G	A	8: 126,447,400	A889V	probably benign	Het
Tbc1d2b	T	C	9: 90,226,209	T430A	probably benign	Het
Tmem217	T	A	17: 29,526,510	Y82F	probably damaging	Het
Ttll9	T	A	2: 152,999,300	Y272*	probably null	Het
Uts2r	A	G	11: 121,161,207	Y299C	probably damaging	Het
Vsig8	T	A	1: 172,560,576	M37K	probably benign	Het
Vwf	G	T	6: 125,639,376	D1218Y	unknown	Het
Wdr11	T	G	7: 129,624,312	M727R	probably benign	Het
Wwc2	A	G	8: 47,900,791	Y103H	possibly damaging	Het
Yod1	T	A	1: 130,719,271	L295*	probably null	Het
Zfp113	G	T	5: 138,145,346	S214*	probably null	Het
Zfp438	T	A	18: 5,213,780	M393L	probably benign	Het
Zfp946	G	A	17: 22,455,771	C502Y	probably benign	Het

Other mutations in Oit3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01457:Oit3	APN	10	59425484	unclassified	probably benign
IGL01665:Oit3	APN	10	59438909	missense	probably damaging	1.00
IGL01839:Oit3	APN	10	59429496	missense	probably damaging	0.98
IGL02028:Oit3	APN	10	59438655	missense	probably damaging	0.98
PIT4585001:Oit3	UTSW	10	59431013	missense	possibly damaging	0.54
R0567:Oit3	UTSW	10	59435978	missense	probably damaging	0.99
R0781:Oit3	UTSW	10	59428194	missense	probably damaging	1.00
R1110:Oit3	UTSW	10	59428194	missense	probably damaging	1.00
R1563:Oit3	UTSW	10	59428074	missense	probably damaging	1.00
R1623:Oit3	UTSW	10	59428239	missense	probably damaging	0.99
R1693:Oit3	UTSW	10	59425417	missense	probably damaging	1.00
R1754:Oit3	UTSW	10	59427940	splice site	probably null
R1853:Oit3	UTSW	10	59441622	critical splice donor site	probably null
R2070:Oit3	UTSW	10	59431013	missense	probably benign	0.03
R2211:Oit3	UTSW	10	59428070	missense	probably damaging	1.00
R2516:Oit3	UTSW	10	59428345	missense	probably damaging	1.00
R2516:Oit3	UTSW	10	59441685	start gained	probably benign
R3103:Oit3	UTSW	10	59438891	missense	probably damaging	0.98
R4414:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4415:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4416:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4417:Oit3	UTSW	10	59428103	missense	probably damaging	1.00
R4584:Oit3	UTSW	10	59425462	missense	probably damaging	1.00
R4734:Oit3	UTSW	10	59424082	missense	probably damaging	0.99
R4748:Oit3	UTSW	10	59424082	missense	probably damaging	0.99
R4749:Oit3	UTSW	10	59424082	missense	probably damaging	0.99
R5070:Oit3	UTSW	10	59424027	missense	probably damaging	1.00
R5521:Oit3	UTSW	10	59435914	missense	probably benign
R6326:Oit3	UTSW	10	59428239	missense	probably damaging	1.00
R6490:Oit3	UTSW	10	59438552	missense	possibly damaging	0.92
R6526:Oit3	UTSW	10	59429640	missense	probably damaging	1.00
R6921:Oit3	UTSW	10	59435945	missense	probably damaging	0.99
R7129:Oit3	UTSW	10	59428344	missense	probably damaging	0.99
R7440:Oit3	UTSW	10	59429570	missense	probably damaging	0.99
R7495:Oit3	UTSW	10	59423943	missense	possibly damaging	0.74
R7512:Oit3	UTSW	10	59438894	missense	probably damaging	1.00
R7866:Oit3	UTSW	10	59424030	missense	probably benign	0.03
R8312:Oit3	UTSW	10	59438810	missense	probably benign	0.01
R8321:Oit3	UTSW	10	59428160	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TAACTCCATCTGTGGGCTTG -3'
(R):5'- ATCAGTCTGAACGAGCCCTG -3'

Sequencing Primer
(F):5'- GGGTACTTACGGCCACAGTAGAC -3'
(R):5'- AGCCCTGGAGGAACACTGAC -3'

Posted On

2018-08-29