Incidental Mutation 'R6766:Crebbp'
ID531945
Institutional Source Beutler Lab
Gene Symbol Crebbp
Ensembl Gene ENSMUSG00000022521
Gene NameCREB binding protein
SynonymsKAT3A, CBP
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6766 (G1)
Quality Score193.009
Status Not validated
Chromosome16
Chromosomal Location4081328-4213997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4117500 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 842 (T842A)
Ref Sequence ENSEMBL: ENSMUSP00000146330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023165] [ENSMUST00000205344] [ENSMUST00000205765]
Predicted Effect probably damaging
Transcript: ENSMUST00000023165
AA Change: T880A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023165
Gene: ENSMUSG00000022521
AA Change: T880A

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 75 89 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 213 233 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
ZnF_TAZ 347 432 2.31e-32 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:KIX 586 666 1.4e-42 PFAM
low complexity region 874 893 N/A INTRINSIC
low complexity region 909 958 N/A INTRINSIC
low complexity region 1045 1065 N/A INTRINSIC
BROMO 1085 1195 4.26e-43 SMART
Blast:KAT11 1265 1308 3e-15 BLAST
KAT11 1343 1649 4.25e-137 SMART
ZnF_ZZ 1702 1743 2.17e-15 SMART
ZnF_TAZ 1767 1845 6.8e-30 SMART
low complexity region 1847 1877 N/A INTRINSIC
low complexity region 1884 1914 N/A INTRINSIC
low complexity region 1942 1971 N/A INTRINSIC
Pfam:Creb_binding 2019 2115 8.2e-38 PFAM
low complexity region 2147 2161 N/A INTRINSIC
low complexity region 2197 2216 N/A INTRINSIC
low complexity region 2260 2279 N/A INTRINSIC
low complexity region 2286 2304 N/A INTRINSIC
low complexity region 2343 2378 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205344
AA Change: T416A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000205685
Predicted Effect probably damaging
Transcript: ENSMUST00000205765
AA Change: T842A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is ubiquitously expressed and is involved in the transcriptional coactivation of many different transcription factors. First isolated as a nuclear protein that binds to cAMP-response element binding protein (CREB), this gene is now known to play critical roles in embryonic development, growth control, and homeostasis by coupling chromatin remodeling to transcription factor recognition. The protein encoded by this gene has intrinsic histone acetyltransferase activity and also acts as a scaffold to stabilize additional protein interactions with the transcription complex. This protein acetylates both histone and non-histone proteins. This protein shares regions of very high sequence similarity with protein p300 in its bromodomain, cysteine-histidine-rich regions, and histone acetyltransferase domain. Mutations in this gene cause Rubinstein-Taybi syndrome (RTS). Chromosomal translocations involving this gene have been associated with acute myeloid leukemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for null or altered alleles die around midgestation with defects in hemopoiesis, blood vessel formation, and neural tube closure. Heterozygotes may exhibit skeletal, cardiac, and hematopoietic defects, retarded growth, and hematologic tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 G A 8: 24,872,630 S17L probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Ankrd34c A G 9: 89,729,328 V320A probably benign Het
Aox2 C A 1: 58,349,068 L1112I possibly damaging Het
Arap2 A C 5: 62,677,100 probably null Het
Atm A T 9: 53,490,282 I1429N probably damaging Het
Ccdc68 A G 18: 69,966,790 N290D probably damaging Het
Chst1 T C 2: 92,613,197 W5R probably damaging Het
Clip1 G T 5: 123,614,764 probably benign Het
Cyp2b13 T C 7: 26,081,811 probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock1 T A 7: 134,756,793 probably null Het
Dst A G 1: 34,294,483 I4800V probably damaging Het
Efcab7 CAAGTAAAGTAA CAAGTAA 4: 99,877,959 probably null Het
Epb41l2 C T 10: 25,473,092 Q382* probably null Het
Fam83e A G 7: 45,726,646 D261G probably damaging Het
Ifnk T G 4: 35,152,134 S21A possibly damaging Het
Ift122 A G 6: 115,926,243 H1157R probably benign Het
Ighv1-67 T C 12: 115,604,034 K67R possibly damaging Het
Inpp4a C A 1: 37,372,341 A97D probably damaging Het
Insm1 T A 2: 146,223,426 Y387* probably null Het
Irgm1 T C 11: 48,866,101 I294M possibly damaging Het
Isoc2b C T 7: 4,851,062 V104M probably damaging Het
Kif2c A C 4: 117,167,083 S311R probably benign Het
Morn3 G A 5: 123,041,207 A60V probably damaging Het
Oit3 T C 10: 59,438,712 N89D probably damaging Het
Olfr1174-ps T A 2: 88,311,751 Q15L noncoding transcript Het
Olfr1221 G T 2: 89,112,296 T72N possibly damaging Het
Olfr1262 T C 2: 90,002,532 V42A probably benign Het
Olfr293 A T 7: 86,664,085 N141I probably damaging Het
Olfr912 A C 9: 38,581,773 R165S probably damaging Het
Pan2 C A 10: 128,314,512 N708K possibly damaging Het
Parp1 T A 1: 180,598,362 V886E probably damaging Het
Pcdha8 C A 18: 36,994,700 A745E probably benign Het
Pcyox1 C T 6: 86,394,408 probably null Het
Prl2c2 A T 13: 13,002,128 probably null Het
Samd1 T C 8: 83,999,732 S473P possibly damaging Het
Slc26a1 A T 5: 108,671,907 D475E probably damaging Het
Slco1c1 T C 6: 141,547,809 V239A possibly damaging Het
Smo T A 6: 29,736,045 L12Q unknown Homo
Srpk1 C T 17: 28,602,753 R229Q possibly damaging Het
Syn2 T A 6: 115,239,401 F191L probably damaging Het
Syngr2 T C 11: 117,813,435 V182A probably benign Het
Tarbp1 G A 8: 126,447,400 A889V probably benign Het
Tbc1d2b T C 9: 90,226,209 T430A probably benign Het
Tmem217 T A 17: 29,526,510 Y82F probably damaging Het
Ttll9 T A 2: 152,999,300 Y272* probably null Het
Uts2r A G 11: 121,161,207 Y299C probably damaging Het
Vsig8 T A 1: 172,560,576 M37K probably benign Het
Vwf G T 6: 125,639,376 D1218Y unknown Het
Wdr11 T G 7: 129,624,312 M727R probably benign Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Yod1 T A 1: 130,719,271 L295* probably null Het
Zfp113 G T 5: 138,145,346 S214* probably null Het
Zfp438 T A 18: 5,213,780 M393L probably benign Het
Zfp946 G A 17: 22,455,771 C502Y probably benign Het
Other mutations in Crebbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Crebbp APN 16 4179552 missense probably benign
IGL01366:Crebbp APN 16 4126506 missense probably damaging 1.00
IGL01457:Crebbp APN 16 4124768 missense probably damaging 0.99
IGL01713:Crebbp APN 16 4128648 missense possibly damaging 0.79
IGL02382:Crebbp APN 16 4108070 missense probably damaging 1.00
IGL02513:Crebbp APN 16 4126605 unclassified probably null
IGL02519:Crebbp APN 16 4101593 missense possibly damaging 0.80
IGL02533:Crebbp APN 16 4107432 missense probably damaging 1.00
IGL02582:Crebbp APN 16 4084277 missense possibly damaging 0.87
IGL02600:Crebbp APN 16 4155018 missense probably benign
IGL02716:Crebbp APN 16 4114878 missense probably benign 0.22
IGL02736:Crebbp APN 16 4154910 missense probably benign 0.00
IGL03349:Crebbp APN 16 4117358 missense possibly damaging 0.69
PIT4418001:Crebbp UTSW 16 4114825 missense probably benign 0.02
R0022:Crebbp UTSW 16 4085228 missense probably damaging 1.00
R0029:Crebbp UTSW 16 4117443 missense probably damaging 1.00
R0098:Crebbp UTSW 16 4091928 missense probably damaging 1.00
R0098:Crebbp UTSW 16 4091928 missense probably damaging 1.00
R0125:Crebbp UTSW 16 4117241 splice site probably benign
R0126:Crebbp UTSW 16 4084063 missense possibly damaging 0.94
R0140:Crebbp UTSW 16 4117499 missense probably damaging 1.00
R0546:Crebbp UTSW 16 4085807 missense probably damaging 0.99
R0705:Crebbp UTSW 16 4155010 missense possibly damaging 0.95
R0801:Crebbp UTSW 16 4088276 missense probably damaging 1.00
R1103:Crebbp UTSW 16 4084061 missense probably damaging 0.97
R1225:Crebbp UTSW 16 4126956 missense probably benign 0.04
R1421:Crebbp UTSW 16 4124647 missense probably damaging 1.00
R1513:Crebbp UTSW 16 4115885 missense probably damaging 1.00
R1531:Crebbp UTSW 16 4084517 missense probably benign 0.04
R1860:Crebbp UTSW 16 4087736 missense possibly damaging 0.68
R1941:Crebbp UTSW 16 4179691 missense probably benign
R1953:Crebbp UTSW 16 4179449 missense probably benign 0.23
R1992:Crebbp UTSW 16 4128697 splice site probably null
R2000:Crebbp UTSW 16 4084252 missense probably damaging 0.98
R2006:Crebbp UTSW 16 4084753 unclassified probably benign
R2022:Crebbp UTSW 16 4085819 missense probably damaging 1.00
R2044:Crebbp UTSW 16 4084823 missense probably benign 0.04
R2185:Crebbp UTSW 16 4084138 missense probably damaging 0.99
R2203:Crebbp UTSW 16 4138777 missense possibly damaging 0.72
R2349:Crebbp UTSW 16 4138910 missense probably damaging 1.00
R2430:Crebbp UTSW 16 4096465 missense probably damaging 1.00
R2438:Crebbp UTSW 16 4154858 missense possibly damaging 0.90
R2842:Crebbp UTSW 16 4109198 missense probably damaging 1.00
R2896:Crebbp UTSW 16 4138816 missense probably damaging 1.00
R2920:Crebbp UTSW 16 4119082 missense probably damaging 0.98
R3118:Crebbp UTSW 16 4109198 missense probably damaging 1.00
R3894:Crebbp UTSW 16 4096102 missense probably benign 0.11
R4177:Crebbp UTSW 16 4119799 missense possibly damaging 0.48
R4692:Crebbp UTSW 16 4114863 missense possibly damaging 0.64
R4790:Crebbp UTSW 16 4180119 missense probably damaging 0.98
R4884:Crebbp UTSW 16 4088375 missense probably damaging 1.00
R4957:Crebbp UTSW 16 4117367 missense probably benign 0.14
R5109:Crebbp UTSW 16 4088431 intron probably benign
R5121:Crebbp UTSW 16 4093511 missense probably damaging 1.00
R5420:Crebbp UTSW 16 4107458 missense probably damaging 1.00
R5455:Crebbp UTSW 16 4085967 missense probably benign 0.45
R5485:Crebbp UTSW 16 4114913 missense probably benign
R5660:Crebbp UTSW 16 4154858 missense possibly damaging 0.90
R5724:Crebbp UTSW 16 4087635 unclassified probably benign
R5771:Crebbp UTSW 16 4119772 missense probably benign 0.03
R5825:Crebbp UTSW 16 4087742 missense probably damaging 0.99
R5919:Crebbp UTSW 16 4108127 missense probably damaging 1.00
R5965:Crebbp UTSW 16 4087661 unclassified probably benign
R6021:Crebbp UTSW 16 4085418 missense probably damaging 1.00
R6146:Crebbp UTSW 16 4084623 nonsense probably null
R6521:Crebbp UTSW 16 4119128 missense probably damaging 0.99
R6571:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6617:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6618:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6634:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6646:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6647:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6836:Crebbp UTSW 16 4180022 missense possibly damaging 0.83
R7022:Crebbp UTSW 16 4117323 missense probably damaging 0.98
R7210:Crebbp UTSW 16 4084257 missense possibly damaging 0.95
R7568:Crebbp UTSW 16 4126489 missense probably benign 0.34
R7672:Crebbp UTSW 16 4084710 missense probably benign 0.06
X0012:Crebbp UTSW 16 4087765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGACTGAGGAGTAGCCAC -3'
(R):5'- AGTCCCTCATGGTTTCAATTGGG -3'

Sequencing Primer
(F):5'- ACAGATGGTGGCTGCACTG -3'
(R):5'- TTACTATCTCTTTTAGGGTCAGGTAC -3'
Posted On2018-08-29