Incidental Mutation 'R6767:Stat4'
ID531953
Institutional Source Beutler Lab
Gene Symbol Stat4
Ensembl Gene ENSMUSG00000062939
Gene Namesignal transducer and activator of transcription 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.447) question?
Stock #R6767 (G1)
Quality Score217.009
Status Validated
Chromosome1
Chromosomal Location51987148-52107189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 52076583 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 227 (M227I)
Ref Sequence ENSEMBL: ENSMUSP00000130713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027277] [ENSMUST00000168302]
Predicted Effect probably benign
Transcript: ENSMUST00000027277
AA Change: M227I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027277
Gene: ENSMUSG00000062939
AA Change: M227I

DomainStartEndE-ValueType
STAT_int 2 122 3.73e-60 SMART
Pfam:STAT_alpha 140 314 2.2e-54 PFAM
Pfam:STAT_bind 316 562 4.7e-76 PFAM
SH2 571 681 9.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168302
AA Change: M227I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130713
Gene: ENSMUSG00000062939
AA Change: M227I

DomainStartEndE-ValueType
STAT_int 2 122 3.73e-60 SMART
Pfam:STAT_alpha 137 314 8.2e-66 PFAM
Pfam:STAT_bind 316 563 3.3e-114 PFAM
SH2 571 681 9.07e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. Homozygous knockout mice for this gene exhibit reduced inflammation and cytokine production in response to immune challenge. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to altered cytokine production of T-cells, impaired IL-12 responses, enhanced Th2 cell development, decreased susceptibility to autoimmune diabetes, altered NK cell responses during viral infection, and increased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 A G 12: 105,766,607 N537D probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Atp8a2 A G 14: 60,046,722 F47S probably damaging Het
Cadps T A 14: 12,550,888 T449S probably damaging Het
Ccdc33 C G 9: 58,033,244 Q489H possibly damaging Het
Cd163 T G 6: 124,304,779 S14A possibly damaging Het
Cemip G A 7: 83,998,624 L83F probably damaging Het
Chrd C T 16: 20,738,626 P665L probably benign Het
Cib4 T A 5: 30,534,245 H44L probably benign Het
Clic1 T A 17: 35,053,053 L99Q probably benign Het
Cnst C T 1: 179,609,954 T361I possibly damaging Het
Dnah6 C A 6: 73,133,608 V1613L probably benign Het
Dnajb8 T C 6: 88,222,652 S57P probably damaging Het
Dyrk3 T C 1: 131,129,590 H282R probably damaging Het
Fasn T C 11: 120,817,487 I651V possibly damaging Het
Gas6 A G 8: 13,465,784 S663P probably damaging Het
Gbp8 T C 5: 105,018,612 M284V probably benign Het
Gm12695 T C 4: 96,762,696 probably null Het
Gm17359 A T 3: 79,430,023 D46V probably benign Het
Gm5346 G A 8: 43,626,914 T91I probably damaging Het
Gm6034 T A 17: 36,043,131 M1K probably null Het
Gm9376 A G 14: 118,267,236 T27A unknown Het
Grid2 A G 6: 63,931,015 D213G probably benign Het
Gsdma3 A T 11: 98,637,884 D388V possibly damaging Het
Hdac9 T A 12: 34,287,529 H716L probably damaging Het
Hist1h4b T A 13: 23,757,022 M1K probably null Het
Hivep1 T C 13: 42,154,727 S148P probably damaging Het
Kctd1 T C 18: 15,062,175 T464A possibly damaging Het
Kera A G 10: 97,609,172 D131G possibly damaging Het
Kif2c C T 4: 117,178,188 R21Q probably benign Het
Luc7l3 G T 11: 94,292,953 D453E probably damaging Het
Mrpl9 A G 3: 94,450,221 probably benign Het
Mtss1 T C 15: 58,953,581 S257G probably benign Het
N4bp2 T C 5: 65,817,187 F1467L probably damaging Het
Naa25 T C 5: 121,439,865 V945A probably damaging Het
Nrg1 T C 8: 31,917,895 I103M probably damaging Het
Olfr1369-ps1 C T 13: 21,116,057 R122C probably benign Het
Orm3 C T 4: 63,356,294 T32I probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Plch1 A T 3: 63,755,344 M246K probably damaging Het
Pld4 A C 12: 112,764,115 D144A possibly damaging Het
Prelp C A 1: 133,912,710 V345L probably benign Het
Rnf121 A G 7: 102,023,412 F238L probably damaging Het
Rnf40 A G 7: 127,596,585 K667R possibly damaging Het
Scgb1b12 A T 7: 32,334,495 N60I probably damaging Het
Serpina3n T G 12: 104,409,062 V131G probably benign Het
Slc22a21 T C 11: 53,979,502 Y119C probably damaging Het
Slc22a28 A G 19: 8,117,045 F204S probably damaging Het
Smc6 T A 12: 11,271,820 D29E possibly damaging Het
Smgc T A 15: 91,841,398 F40Y possibly damaging Het
Sorcs3 G T 19: 48,713,571 L630F probably damaging Het
Sphk1 A G 11: 116,536,156 K306E possibly damaging Het
Spsb1 C T 4: 149,906,844 G89D probably damaging Het
Syngr4 A G 7: 45,887,491 V116A possibly damaging Het
Tacc1 T C 8: 25,240,800 M1V probably null Het
Tcf7l1 T G 6: 72,631,292 K355Q probably damaging Het
Tmem192 T C 8: 64,964,236 S36P probably damaging Het
Top3a G T 11: 60,750,753 N368K possibly damaging Het
Tpk1 T A 6: 43,346,793 I241F possibly damaging Het
Trappc10 A G 10: 78,193,511 I1064T possibly damaging Het
Vmn1r18 T A 6: 57,390,221 K116M probably damaging Het
Vmn2r40 A T 7: 8,920,140 H407Q unknown Het
Vmn2r91 T A 17: 18,107,545 L467H probably damaging Het
Wdr59 G T 8: 111,476,101 S603R probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp324 A C 7: 12,970,600 K74N probably null Het
Zfyve16 A G 13: 92,508,199 L1165P probably damaging Het
Other mutations in Stat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Stat4 APN 1 52102878 missense probably damaging 1.00
IGL00482:Stat4 APN 1 52074697 missense probably benign 0.05
IGL01395:Stat4 APN 1 52011874 missense probably damaging 1.00
IGL01533:Stat4 APN 1 52098419 missense probably damaging 1.00
IGL01943:Stat4 APN 1 52096855 missense possibly damaging 0.94
IGL02114:Stat4 APN 1 52102865 missense probably damaging 1.00
IGL02151:Stat4 APN 1 52013870 missense probably damaging 0.99
IGL02601:Stat4 APN 1 52098415 missense probably damaging 1.00
R0016:Stat4 UTSW 1 52068780 missense probably benign 0.01
R0243:Stat4 UTSW 1 52011857 missense probably benign 0.22
R0329:Stat4 UTSW 1 52090870 intron probably benign
R0973:Stat4 UTSW 1 52096820 missense probably damaging 0.99
R1144:Stat4 UTSW 1 52084129 splice site probably benign
R1187:Stat4 UTSW 1 52076677 missense probably damaging 1.00
R1331:Stat4 UTSW 1 52013927 missense probably benign 0.20
R1401:Stat4 UTSW 1 52071947 splice site probably benign
R1529:Stat4 UTSW 1 52011793 missense probably damaging 1.00
R1711:Stat4 UTSW 1 52106925 missense probably damaging 1.00
R2213:Stat4 UTSW 1 52013855 missense probably damaging 0.98
R3003:Stat4 UTSW 1 52102986 missense probably damaging 1.00
R3683:Stat4 UTSW 1 52013822 missense possibly damaging 0.89
R3789:Stat4 UTSW 1 52011796 missense probably benign 0.07
R3919:Stat4 UTSW 1 52096822 missense possibly damaging 0.62
R4320:Stat4 UTSW 1 52074707 missense probably benign
R4373:Stat4 UTSW 1 52071941 critical splice donor site probably null
R5024:Stat4 UTSW 1 52082570 missense possibly damaging 0.80
R5103:Stat4 UTSW 1 52071895 missense probably damaging 0.97
R5206:Stat4 UTSW 1 52105236 missense probably damaging 0.99
R5944:Stat4 UTSW 1 52074739 missense probably damaging 1.00
R5961:Stat4 UTSW 1 52065384 missense possibly damaging 0.50
R6001:Stat4 UTSW 1 52096867 missense probably damaging 0.96
R6161:Stat4 UTSW 1 52074677 missense possibly damaging 0.94
R6262:Stat4 UTSW 1 52102201 missense probably null 1.00
R6701:Stat4 UTSW 1 52102974 missense probably damaging 1.00
R6989:Stat4 UTSW 1 52068815 missense probably benign 0.09
R7507:Stat4 UTSW 1 52078574 missense probably damaging 1.00
R7539:Stat4 UTSW 1 52071709 intron probably null
R7546:Stat4 UTSW 1 52098463 missense probably damaging 0.98
R7616:Stat4 UTSW 1 52013878 nonsense probably null
R7751:Stat4 UTSW 1 52082552 missense possibly damaging 0.73
R8052:Stat4 UTSW 1 52079773 missense probably damaging 1.00
R8311:Stat4 UTSW 1 52102916 missense probably damaging 1.00
Z1177:Stat4 UTSW 1 52084099 nonsense probably null
Z1177:Stat4 UTSW 1 52098485 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GGTCACAGTTCTCATGCTATTATTCAG -3'
(R):5'- AGACTGCACTCTCACTGAGC -3'

Sequencing Primer
(F):5'- TGACTTTATTGTTTGAGAAGGCAC -3'
(R):5'- TGCACTCTCACTGAGCAACTG -3'
Posted On2018-08-29