Incidental Mutation 'R6767:Prelp'
ID531955
Institutional Source Beutler Lab
Gene Symbol Prelp
Ensembl Gene ENSMUSG00000041577
Gene Nameproline arginine-rich end leucine-rich repeat
Synonyms7330409J17Rik, SLRR2A
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6767 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location133910304-133921414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 133912710 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 345 (V345L)
Ref Sequence ENSEMBL: ENSMUSP00000048803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048432] [ENSMUST00000153617]
Predicted Effect probably benign
Transcript: ENSMUST00000048432
AA Change: V345L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000048803
Gene: ENSMUSG00000041577
AA Change: V345L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 23 63 N/A INTRINSIC
LRRNT 68 102 5.86e-11 SMART
LRR 98 120 3.27e1 SMART
LRR 122 144 1.37e2 SMART
LRR 145 168 2.14e0 SMART
LRR 169 189 4.97e0 SMART
LRR 190 215 2.47e1 SMART
LRR 216 239 9.75e0 SMART
LRR 241 260 2.15e2 SMART
LRR 286 309 1.53e1 SMART
Blast:LRR 345 369 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000153617
SMART Domains Protein: ENSMUSP00000123262
Gene: ENSMUSG00000010311

DomainStartEndE-ValueType
low complexity region 42 70 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
LRR 173 195 1.22e1 SMART
LRR 196 218 4.21e1 SMART
LRR 242 265 1.76e1 SMART
LRR 266 286 3.36e1 SMART
Meta Mutation Damage Score 0.1339 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a leucine-rich repeat protein present in connective tissue extracellular matrix. This protein functions as a molecule anchoring basement membranes to the underlying connective tissue. This protein has been shown to bind type I collagen to basement membranes and type II collagen to cartilage. It also binds the basement membrane heparan sulfate proteoglycan perlecan. This protein is suggested to be involved in the pathogenesis of Hutchinson-Gilford progeria (HGP), which is reported to lack the binding of collagen in basement membranes and cartilage. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 A G 12: 105,766,607 N537D probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Atp8a2 A G 14: 60,046,722 F47S probably damaging Het
Cadps T A 14: 12,550,888 T449S probably damaging Het
Ccdc33 C G 9: 58,033,244 Q489H possibly damaging Het
Cd163 T G 6: 124,304,779 S14A possibly damaging Het
Cemip G A 7: 83,998,624 L83F probably damaging Het
Chrd C T 16: 20,738,626 P665L probably benign Het
Cib4 T A 5: 30,534,245 H44L probably benign Het
Clic1 T A 17: 35,053,053 L99Q probably benign Het
Cnst C T 1: 179,609,954 T361I possibly damaging Het
Dnah6 C A 6: 73,133,608 V1613L probably benign Het
Dnajb8 T C 6: 88,222,652 S57P probably damaging Het
Dyrk3 T C 1: 131,129,590 H282R probably damaging Het
Fasn T C 11: 120,817,487 I651V possibly damaging Het
Gas6 A G 8: 13,465,784 S663P probably damaging Het
Gbp8 T C 5: 105,018,612 M284V probably benign Het
Gm12695 T C 4: 96,762,696 probably null Het
Gm17359 A T 3: 79,430,023 D46V probably benign Het
Gm5346 G A 8: 43,626,914 T91I probably damaging Het
Gm6034 T A 17: 36,043,131 M1K probably null Het
Gm9376 A G 14: 118,267,236 T27A unknown Het
Grid2 A G 6: 63,931,015 D213G probably benign Het
Gsdma3 A T 11: 98,637,884 D388V possibly damaging Het
Hdac9 T A 12: 34,287,529 H716L probably damaging Het
Hist1h4b T A 13: 23,757,022 M1K probably null Het
Hivep1 T C 13: 42,154,727 S148P probably damaging Het
Kctd1 T C 18: 15,062,175 T464A possibly damaging Het
Kera A G 10: 97,609,172 D131G possibly damaging Het
Kif2c C T 4: 117,178,188 R21Q probably benign Het
Luc7l3 G T 11: 94,292,953 D453E probably damaging Het
Mrpl9 A G 3: 94,450,221 probably benign Het
Mtss1 T C 15: 58,953,581 S257G probably benign Het
N4bp2 T C 5: 65,817,187 F1467L probably damaging Het
Naa25 T C 5: 121,439,865 V945A probably damaging Het
Nrg1 T C 8: 31,917,895 I103M probably damaging Het
Olfr1369-ps1 C T 13: 21,116,057 R122C probably benign Het
Orm3 C T 4: 63,356,294 T32I probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Plch1 A T 3: 63,755,344 M246K probably damaging Het
Pld4 A C 12: 112,764,115 D144A possibly damaging Het
Rnf121 A G 7: 102,023,412 F238L probably damaging Het
Rnf40 A G 7: 127,596,585 K667R possibly damaging Het
Scgb1b12 A T 7: 32,334,495 N60I probably damaging Het
Serpina3n T G 12: 104,409,062 V131G probably benign Het
Slc22a21 T C 11: 53,979,502 Y119C probably damaging Het
Slc22a28 A G 19: 8,117,045 F204S probably damaging Het
Smc6 T A 12: 11,271,820 D29E possibly damaging Het
Smgc T A 15: 91,841,398 F40Y possibly damaging Het
Sorcs3 G T 19: 48,713,571 L630F probably damaging Het
Sphk1 A G 11: 116,536,156 K306E possibly damaging Het
Spsb1 C T 4: 149,906,844 G89D probably damaging Het
Stat4 G T 1: 52,076,583 M227I probably benign Het
Syngr4 A G 7: 45,887,491 V116A possibly damaging Het
Tacc1 T C 8: 25,240,800 M1V probably null Het
Tcf7l1 T G 6: 72,631,292 K355Q probably damaging Het
Tmem192 T C 8: 64,964,236 S36P probably damaging Het
Top3a G T 11: 60,750,753 N368K possibly damaging Het
Tpk1 T A 6: 43,346,793 I241F possibly damaging Het
Trappc10 A G 10: 78,193,511 I1064T possibly damaging Het
Vmn1r18 T A 6: 57,390,221 K116M probably damaging Het
Vmn2r40 A T 7: 8,920,140 H407Q unknown Het
Vmn2r91 T A 17: 18,107,545 L467H probably damaging Het
Wdr59 G T 8: 111,476,101 S603R probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp324 A C 7: 12,970,600 K74N probably null Het
Zfyve16 A G 13: 92,508,199 L1165P probably damaging Het
Other mutations in Prelp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Prelp APN 1 133914807 missense probably benign 0.03
IGL02869:Prelp APN 1 133915267 nonsense probably null
PIT4576001:Prelp UTSW 1 133915165 missense possibly damaging 0.78
R0972:Prelp UTSW 1 133914676 missense probably damaging 0.99
R1728:Prelp UTSW 1 133915131 missense probably benign
R1729:Prelp UTSW 1 133915131 missense probably benign
R1730:Prelp UTSW 1 133915131 missense probably benign
R1739:Prelp UTSW 1 133915131 missense probably benign
R1762:Prelp UTSW 1 133915131 missense probably benign
R1783:Prelp UTSW 1 133915131 missense probably benign
R1784:Prelp UTSW 1 133915131 missense probably benign
R1785:Prelp UTSW 1 133915131 missense probably benign
R1843:Prelp UTSW 1 133914757 missense probably damaging 0.99
R2049:Prelp UTSW 1 133915131 missense probably benign
R2130:Prelp UTSW 1 133915131 missense probably benign
R2131:Prelp UTSW 1 133915131 missense probably benign
R2133:Prelp UTSW 1 133915131 missense probably benign
R2141:Prelp UTSW 1 133915131 missense probably benign
R2142:Prelp UTSW 1 133915131 missense probably benign
R4694:Prelp UTSW 1 133914747 missense probably damaging 0.96
R6398:Prelp UTSW 1 133914741 missense probably damaging 1.00
R6415:Prelp UTSW 1 133912778 missense probably benign 0.38
R6415:Prelp UTSW 1 133914657 missense probably damaging 1.00
R6678:Prelp UTSW 1 133914775 missense probably benign 0.00
R7644:Prelp UTSW 1 133914618 missense probably benign 0.16
R7834:Prelp UTSW 1 133914772 missense probably damaging 0.96
R8419:Prelp UTSW 1 133915282 missense probably benign 0.01
X0066:Prelp UTSW 1 133915276 missense probably benign 0.00
Z1176:Prelp UTSW 1 133914881 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCATCCTCACGAAGGGAC -3'
(R):5'- GGATAGACAATGGAGCCCACAC -3'

Sequencing Primer
(F):5'- CATCCTCACGAAGGGACGAGAG -3'
(R):5'- ATGGAGCCCACACACTCTTGG -3'
Posted On2018-08-29