Mutagenetix > Incidental Mutations

Incidental Mutation 'R6767:Cnst'

531957

Institutional Source

Beutler Lab

Gene Symbol

Cnst

Ensembl Gene

ENSMUSG00000038949

Gene Name

consortin, connexin sorting protein

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.118) question?

Stock #

R6767 (G1)

Quality Score

176.009

Status

Validated

Chromosome

Chromosomal Location

179546370-179627478 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 179609954 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 361 (T361I)

Ref Sequence

ENSEMBL: ENSMUSP00000048205 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040706]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040706
AA Change: T361I

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000048205
Gene: ENSMUSG00000038949
AA Change: T361I

Domain	Start	End	E-Value	Type
low complexity region	109	126	N/A	INTRINSIC
low complexity region	142	150	N/A	INTRINSIC
low complexity region	555	566	N/A	INTRINSIC
Pfam:Consortin_C	598	709	3.4e-56	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 95.9%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Targeting of numerous transmembrane proteins to the cell surface is thought to depend on their recognition by cargo receptors that interact with the adaptor machinery for anterograde traffic at the distal end of the Golgi complex. Consortin (CNST) is an integral membrane protein that acts as a binding partner of connexins, the building blocks of gap junctions, and acts as a trans-Golgi network (TGN) receptor involved in connexin targeting to the plasma membrane and recycling from the cell surface (del Castillo et al., 2010 [PubMed 19864490]).[supplied by OMIM, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ak7	A	G	12: 105,766,607	N537D	probably damaging	Het
Akt3	A	T	1: 177,050,190	Y337*	probably null	Het
Atp8a2	A	G	14: 60,046,722	F47S	probably damaging	Het
Cadps	T	A	14: 12,550,888	T449S	probably damaging	Het
Ccdc33	C	G	9: 58,033,244	Q489H	possibly damaging	Het
Cd163	T	G	6: 124,304,779	S14A	possibly damaging	Het
Cemip	G	A	7: 83,998,624	L83F	probably damaging	Het
Chrd	C	T	16: 20,738,626	P665L	probably benign	Het
Cib4	T	A	5: 30,534,245	H44L	probably benign	Het
Clic1	T	A	17: 35,053,053	L99Q	probably benign	Het
Dnah6	C	A	6: 73,133,608	V1613L	probably benign	Het
Dnajb8	T	C	6: 88,222,652	S57P	probably damaging	Het
Dyrk3	T	C	1: 131,129,590	H282R	probably damaging	Het
Fasn	T	C	11: 120,817,487	I651V	possibly damaging	Het
Gas6	A	G	8: 13,465,784	S663P	probably damaging	Het
Gbp8	T	C	5: 105,018,612	M284V	probably benign	Het
Gm12695	T	C	4: 96,762,696		probably null	Het
Gm17359	A	T	3: 79,430,023	D46V	probably benign	Het
Gm5346	G	A	8: 43,626,914	T91I	probably damaging	Het
Gm6034	T	A	17: 36,043,131	M1K	probably null	Het
Gm9376	A	G	14: 118,267,236	T27A	unknown	Het
Grid2	A	G	6: 63,931,015	D213G	probably benign	Het
Gsdma3	A	T	11: 98,637,884	D388V	possibly damaging	Het
Hdac9	T	A	12: 34,287,529	H716L	probably damaging	Het
Hist1h4b	T	A	13: 23,757,022	M1K	probably null	Het
Hivep1	T	C	13: 42,154,727	S148P	probably damaging	Het
Kctd1	T	C	18: 15,062,175	T464A	possibly damaging	Het
Kera	A	G	10: 97,609,172	D131G	possibly damaging	Het
Kif2c	C	T	4: 117,178,188	R21Q	probably benign	Het
Luc7l3	G	T	11: 94,292,953	D453E	probably damaging	Het
Mrpl9	A	G	3: 94,450,221		probably benign	Het
Mtss1	T	C	15: 58,953,581	S257G	probably benign	Het
N4bp2	T	C	5: 65,817,187	F1467L	probably damaging	Het
Naa25	T	C	5: 121,439,865	V945A	probably damaging	Het
Nrg1	T	C	8: 31,917,895	I103M	probably damaging	Het
Olfr1369-ps1	C	T	13: 21,116,057	R122C	probably benign	Het
Orm3	C	T	4: 63,356,294	T32I	probably damaging	Het
Pi4ka	A	G	16: 17,376,982	L184P	possibly damaging	Het
Plch1	A	T	3: 63,755,344	M246K	probably damaging	Het
Pld4	A	C	12: 112,764,115	D144A	possibly damaging	Het
Prelp	C	A	1: 133,912,710	V345L	probably benign	Het
Rnf121	A	G	7: 102,023,412	F238L	probably damaging	Het
Rnf40	A	G	7: 127,596,585	K667R	possibly damaging	Het
Scgb1b12	A	T	7: 32,334,495	N60I	probably damaging	Het
Serpina3n	T	G	12: 104,409,062	V131G	probably benign	Het
Slc22a21	T	C	11: 53,979,502	Y119C	probably damaging	Het
Slc22a28	A	G	19: 8,117,045	F204S	probably damaging	Het
Smc6	T	A	12: 11,271,820	D29E	possibly damaging	Het
Smgc	T	A	15: 91,841,398	F40Y	possibly damaging	Het
Sorcs3	G	T	19: 48,713,571	L630F	probably damaging	Het
Sphk1	A	G	11: 116,536,156	K306E	possibly damaging	Het
Spsb1	C	T	4: 149,906,844	G89D	probably damaging	Het
Stat4	G	T	1: 52,076,583	M227I	probably benign	Het
Syngr4	A	G	7: 45,887,491	V116A	possibly damaging	Het
Tacc1	T	C	8: 25,240,800	M1V	probably null	Het
Tcf7l1	T	G	6: 72,631,292	K355Q	probably damaging	Het
Tmem192	T	C	8: 64,964,236	S36P	probably damaging	Het
Top3a	G	T	11: 60,750,753	N368K	possibly damaging	Het
Tpk1	T	A	6: 43,346,793	I241F	possibly damaging	Het
Trappc10	A	G	10: 78,193,511	I1064T	possibly damaging	Het
Vmn1r18	T	A	6: 57,390,221	K116M	probably damaging	Het
Vmn2r40	A	T	7: 8,920,140	H407Q	unknown	Het
Vmn2r91	T	A	17: 18,107,545	L467H	probably damaging	Het
Wdr59	G	T	8: 111,476,101	S603R	probably damaging	Het
Wwc2	A	G	8: 47,900,791	Y103H	possibly damaging	Het
Zfp324	A	C	7: 12,970,600	K74N	probably null	Het
Zfyve16	A	G	13: 92,508,199	L1165P	probably damaging	Het

Other mutations in Cnst

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00917:Cnst	APN	1	179624992	splice site	probably benign
R0360:Cnst	UTSW	1	179579535	missense	probably benign	0.00
R1391:Cnst	UTSW	1	179579486	missense	possibly damaging	0.81
R1743:Cnst	UTSW	1	179610392	missense	probably benign	0.18
R1909:Cnst	UTSW	1	179622791	missense	probably damaging	1.00
R3856:Cnst	UTSW	1	179579714	missense	probably benign	0.02
R4565:Cnst	UTSW	1	179604549	missense	probably damaging	1.00
R5041:Cnst	UTSW	1	179605028	missense	probably damaging	0.99
R5072:Cnst	UTSW	1	179622886	missense	possibly damaging	0.61
R5087:Cnst	UTSW	1	179622813	missense	possibly damaging	0.82
R5294:Cnst	UTSW	1	179610440	missense	probably benign	0.03
R5349:Cnst	UTSW	1	179622897	missense	possibly damaging	0.58
R5394:Cnst	UTSW	1	179601736	splice site	probably benign
R6020:Cnst	UTSW	1	179609875	missense	probably benign
R6198:Cnst	UTSW	1	179592865	missense	probably damaging	1.00
R6669:Cnst	UTSW	1	179605073	splice site	probably null
R7007:Cnst	UTSW	1	179610568	missense	probably damaging	1.00
R7179:Cnst	UTSW	1	179579382	start gained	probably benign
R7356:Cnst	UTSW	1	179606530	missense	probably benign	0.01
R7730:Cnst	UTSW	1	179625085	missense	probably damaging	1.00
R7900:Cnst	UTSW	1	179622888	missense	probably damaging	1.00
R8073:Cnst	UTSW	1	179606437	missense	probably benign	0.00
R8194:Cnst	UTSW	1	179610194	missense	probably benign	0.00
Z1088:Cnst	UTSW	1	179579565	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATTGAAACCTGTCCCAGCAC -3'
(R):5'- GGTGTGCCTGTGAATATTTACCC -3'

Sequencing Primer
(F):5'- TCCCAGCACGGATCCAAGTG -3'
(R):5'- TCTGAAATCAACCCAGGCAGTG -3'

Posted On

2018-08-29