Incidental Mutation 'R6767:Rnf40'
ID531982
Institutional Source Beutler Lab
Gene Symbol Rnf40
Ensembl Gene ENSMUSG00000030816
Gene Namering finger protein 40
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R6767 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location127588767-127604799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127596585 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 667 (K667R)
Ref Sequence ENSEMBL: ENSMUSP00000146310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033088] [ENSMUST00000205694] [ENSMUST00000206914]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033088
AA Change: K627R

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033088
Gene: ENSMUSG00000030816
AA Change: K627R

DomainStartEndE-ValueType
coiled coil region 55 86 N/A INTRINSIC
coiled coil region 189 209 N/A INTRINSIC
coiled coil region 231 377 N/A INTRINSIC
coiled coil region 437 525 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
coiled coil region 629 760 N/A INTRINSIC
coiled coil region 800 839 N/A INTRINSIC
RING 948 986 1.86e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000205694
AA Change: K667R

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206914
AA Change: K567R

PolyPhen 2 Score 0.767 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif known to be involved in protein-protein and protein-DNA interactions. This protein was reported to interact with the tumor suppressor protein RB1. Studies of the rat counterpart suggested that this protein may function as an E3 ubiquitin-protein ligase, and facilitate the ubiquitination and degradation of syntaxin 1, which is an essential component of the neurotransmitter release machinery. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 A G 12: 105,766,607 N537D probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Atp8a2 A G 14: 60,046,722 F47S probably damaging Het
Cadps T A 14: 12,550,888 T449S probably damaging Het
Ccdc33 C G 9: 58,033,244 Q489H possibly damaging Het
Cd163 T G 6: 124,304,779 S14A possibly damaging Het
Cemip G A 7: 83,998,624 L83F probably damaging Het
Chrd C T 16: 20,738,626 P665L probably benign Het
Cib4 T A 5: 30,534,245 H44L probably benign Het
Clic1 T A 17: 35,053,053 L99Q probably benign Het
Cnst C T 1: 179,609,954 T361I possibly damaging Het
Dnah6 C A 6: 73,133,608 V1613L probably benign Het
Dnajb8 T C 6: 88,222,652 S57P probably damaging Het
Dyrk3 T C 1: 131,129,590 H282R probably damaging Het
Fasn T C 11: 120,817,487 I651V possibly damaging Het
Gas6 A G 8: 13,465,784 S663P probably damaging Het
Gbp8 T C 5: 105,018,612 M284V probably benign Het
Gm12695 T C 4: 96,762,696 probably null Het
Gm17359 A T 3: 79,430,023 D46V probably benign Het
Gm5346 G A 8: 43,626,914 T91I probably damaging Het
Gm6034 T A 17: 36,043,131 M1K probably null Het
Gm9376 A G 14: 118,267,236 T27A unknown Het
Grid2 A G 6: 63,931,015 D213G probably benign Het
Gsdma3 A T 11: 98,637,884 D388V possibly damaging Het
Hdac9 T A 12: 34,287,529 H716L probably damaging Het
Hist1h4b T A 13: 23,757,022 M1K probably null Het
Hivep1 T C 13: 42,154,727 S148P probably damaging Het
Kctd1 T C 18: 15,062,175 T464A possibly damaging Het
Kera A G 10: 97,609,172 D131G possibly damaging Het
Kif2c C T 4: 117,178,188 R21Q probably benign Het
Luc7l3 G T 11: 94,292,953 D453E probably damaging Het
Mrpl9 A G 3: 94,450,221 probably benign Het
Mtss1 T C 15: 58,953,581 S257G probably benign Het
N4bp2 T C 5: 65,817,187 F1467L probably damaging Het
Naa25 T C 5: 121,439,865 V945A probably damaging Het
Nrg1 T C 8: 31,917,895 I103M probably damaging Het
Olfr1369-ps1 C T 13: 21,116,057 R122C probably benign Het
Orm3 C T 4: 63,356,294 T32I probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Plch1 A T 3: 63,755,344 M246K probably damaging Het
Pld4 A C 12: 112,764,115 D144A possibly damaging Het
Prelp C A 1: 133,912,710 V345L probably benign Het
Rnf121 A G 7: 102,023,412 F238L probably damaging Het
Scgb1b12 A T 7: 32,334,495 N60I probably damaging Het
Serpina3n T G 12: 104,409,062 V131G probably benign Het
Slc22a21 T C 11: 53,979,502 Y119C probably damaging Het
Slc22a28 A G 19: 8,117,045 F204S probably damaging Het
Smc6 T A 12: 11,271,820 D29E possibly damaging Het
Smgc T A 15: 91,841,398 F40Y possibly damaging Het
Sorcs3 G T 19: 48,713,571 L630F probably damaging Het
Sphk1 A G 11: 116,536,156 K306E possibly damaging Het
Spsb1 C T 4: 149,906,844 G89D probably damaging Het
Stat4 G T 1: 52,076,583 M227I probably benign Het
Syngr4 A G 7: 45,887,491 V116A possibly damaging Het
Tacc1 T C 8: 25,240,800 M1V probably null Het
Tcf7l1 T G 6: 72,631,292 K355Q probably damaging Het
Tmem192 T C 8: 64,964,236 S36P probably damaging Het
Top3a G T 11: 60,750,753 N368K possibly damaging Het
Tpk1 T A 6: 43,346,793 I241F possibly damaging Het
Trappc10 A G 10: 78,193,511 I1064T possibly damaging Het
Vmn1r18 T A 6: 57,390,221 K116M probably damaging Het
Vmn2r40 A T 7: 8,920,140 H407Q unknown Het
Vmn2r91 T A 17: 18,107,545 L467H probably damaging Het
Wdr59 G T 8: 111,476,101 S603R probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp324 A C 7: 12,970,600 K74N probably null Het
Zfyve16 A G 13: 92,508,199 L1165P probably damaging Het
Other mutations in Rnf40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02155:Rnf40 APN 7 127590716 splice site probably benign
IGL02331:Rnf40 APN 7 127589827 missense probably benign
IGL02626:Rnf40 APN 7 127596572 missense probably damaging 1.00
IGL02867:Rnf40 APN 7 127591429 nonsense probably null
IGL02889:Rnf40 APN 7 127591429 nonsense probably null
IGL03353:Rnf40 APN 7 127592891 nonsense probably null
R0103:Rnf40 UTSW 7 127600571 missense probably damaging 1.00
R0103:Rnf40 UTSW 7 127600571 missense probably damaging 1.00
R0133:Rnf40 UTSW 7 127596860 synonymous probably null
R0554:Rnf40 UTSW 7 127602584 missense probably damaging 1.00
R0563:Rnf40 UTSW 7 127592876 missense probably damaging 1.00
R1523:Rnf40 UTSW 7 127590615 missense probably damaging 0.99
R1551:Rnf40 UTSW 7 127596334 missense possibly damaging 0.88
R1804:Rnf40 UTSW 7 127595948 missense possibly damaging 0.59
R1929:Rnf40 UTSW 7 127591784 missense probably damaging 0.99
R2194:Rnf40 UTSW 7 127597235 missense probably damaging 1.00
R2356:Rnf40 UTSW 7 127591576 missense probably damaging 0.99
R4839:Rnf40 UTSW 7 127592640 nonsense probably null
R5071:Rnf40 UTSW 7 127597286 missense probably damaging 1.00
R5074:Rnf40 UTSW 7 127597286 missense probably damaging 1.00
R5292:Rnf40 UTSW 7 127595948 missense possibly damaging 0.59
R5537:Rnf40 UTSW 7 127596089 missense probably benign 0.05
R5547:Rnf40 UTSW 7 127589130 critical splice donor site probably null
R5871:Rnf40 UTSW 7 127591585 missense probably damaging 0.97
R6834:Rnf40 UTSW 7 127596406 missense probably benign 0.18
R6969:Rnf40 UTSW 7 127596323 missense possibly damaging 0.89
R6980:Rnf40 UTSW 7 127594677 missense probably damaging 1.00
R7626:Rnf40 UTSW 7 127589875 missense probably benign
X0026:Rnf40 UTSW 7 127594695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGCCTCAACTCTGTCAAG -3'
(R):5'- TCAACGTTGGTCCATACAGTGAG -3'

Sequencing Primer
(F):5'- AACTCTGTCAAGGGCTGATC -3'
(R):5'- TGGTCCATACAGTGAGAATAAAAAC -3'
Posted On2018-08-29