Mutagenetix > Incidental Mutations

Incidental Mutation 'R6767:Gas6'

531983

Institutional Source

Beutler Lab

Gene Symbol

Gas6

Ensembl Gene

ENSMUSG00000031451

Gene Name

growth arrest specific 6

Synonyms

growth arrest-specific, Gas-6, GAS 6

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6767 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

13465374-13494490 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 13465784 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 663 (S663P)

Ref Sequence

ENSEMBL: ENSMUSP00000033828 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033828] [ENSMUST00000167071] [ENSMUST00000167505] [ENSMUST00000210804]

Predicted Effect

probably damaging
Transcript: ENSMUST00000033828
AA Change: S663P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000033828
Gene: ENSMUSG00000031451
AA Change: S663P

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
GLA	26	90	6.66e-30	SMART
EGF	116	151	3.97e0	SMART
EGF_CA	153	193	3.1e-11	SMART
EGF_CA	194	234	1.91e-11	SMART
EGF_CA	235	275	1.25e-6	SMART
LamG	314	450	2.71e-24	SMART
LamG	502	647	1.27e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167071

SMART Domains

Protein: ENSMUSP00000127421
Gene: ENSMUSG00000038457

Domain	Start	End	E-Value	Type
Pfam:FAM70	1	68	8.2e-28	PFAM
Pfam:FAM70	66	307	1.8e-119	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000167505

SMART Domains

Protein: ENSMUSP00000130504
Gene: ENSMUSG00000038457

Domain	Start	End	E-Value	Type
Pfam:FAM70	6	328	6e-166	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000210804

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 95.9%

Validation Efficiency

100% (67/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a gamma-carboxyglutamic acid (Gla)-containing protein thought to be involved in the stimulation of cell proliferation. This gene is frequently overexpressed in many cancers and has been implicated as an adverse prognostic marker. Elevated protein levels are additionally associated with a variety of disease states, including venous thromboembolic disease, systemic lupus erythematosus, chronic renal failure, and preeclampsia. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice are protected against arterial and venous thrombosis, and though platelet aggregation is impaired, spontaneous or excess trauma-induced bleeding is not observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ak7	A	G	12: 105,766,607	N537D	probably damaging	Het
Akt3	A	T	1: 177,050,190	Y337*	probably null	Het
Atp8a2	A	G	14: 60,046,722	F47S	probably damaging	Het
Cadps	T	A	14: 12,550,888	T449S	probably damaging	Het
Ccdc33	C	G	9: 58,033,244	Q489H	possibly damaging	Het
Cd163	T	G	6: 124,304,779	S14A	possibly damaging	Het
Cemip	G	A	7: 83,998,624	L83F	probably damaging	Het
Chrd	C	T	16: 20,738,626	P665L	probably benign	Het
Cib4	T	A	5: 30,534,245	H44L	probably benign	Het
Clic1	T	A	17: 35,053,053	L99Q	probably benign	Het
Cnst	C	T	1: 179,609,954	T361I	possibly damaging	Het
Dnah6	C	A	6: 73,133,608	V1613L	probably benign	Het
Dnajb8	T	C	6: 88,222,652	S57P	probably damaging	Het
Dyrk3	T	C	1: 131,129,590	H282R	probably damaging	Het
Fasn	T	C	11: 120,817,487	I651V	possibly damaging	Het
Gbp8	T	C	5: 105,018,612	M284V	probably benign	Het
Gm12695	T	C	4: 96,762,696		probably null	Het
Gm17359	A	T	3: 79,430,023	D46V	probably benign	Het
Gm5346	G	A	8: 43,626,914	T91I	probably damaging	Het
Gm6034	T	A	17: 36,043,131	M1K	probably null	Het
Gm9376	A	G	14: 118,267,236	T27A	unknown	Het
Grid2	A	G	6: 63,931,015	D213G	probably benign	Het
Gsdma3	A	T	11: 98,637,884	D388V	possibly damaging	Het
Hdac9	T	A	12: 34,287,529	H716L	probably damaging	Het
Hist1h4b	T	A	13: 23,757,022	M1K	probably null	Het
Hivep1	T	C	13: 42,154,727	S148P	probably damaging	Het
Kctd1	T	C	18: 15,062,175	T464A	possibly damaging	Het
Kera	A	G	10: 97,609,172	D131G	possibly damaging	Het
Kif2c	C	T	4: 117,178,188	R21Q	probably benign	Het
Luc7l3	G	T	11: 94,292,953	D453E	probably damaging	Het
Mrpl9	A	G	3: 94,450,221		probably benign	Het
Mtss1	T	C	15: 58,953,581	S257G	probably benign	Het
N4bp2	T	C	5: 65,817,187	F1467L	probably damaging	Het
Naa25	T	C	5: 121,439,865	V945A	probably damaging	Het
Nrg1	T	C	8: 31,917,895	I103M	probably damaging	Het
Olfr1369-ps1	C	T	13: 21,116,057	R122C	probably benign	Het
Orm3	C	T	4: 63,356,294	T32I	probably damaging	Het
Pi4ka	A	G	16: 17,376,982	L184P	possibly damaging	Het
Plch1	A	T	3: 63,755,344	M246K	probably damaging	Het
Pld4	A	C	12: 112,764,115	D144A	possibly damaging	Het
Prelp	C	A	1: 133,912,710	V345L	probably benign	Het
Rnf121	A	G	7: 102,023,412	F238L	probably damaging	Het
Rnf40	A	G	7: 127,596,585	K667R	possibly damaging	Het
Scgb1b12	A	T	7: 32,334,495	N60I	probably damaging	Het
Serpina3n	T	G	12: 104,409,062	V131G	probably benign	Het
Slc22a21	T	C	11: 53,979,502	Y119C	probably damaging	Het
Slc22a28	A	G	19: 8,117,045	F204S	probably damaging	Het
Smc6	T	A	12: 11,271,820	D29E	possibly damaging	Het
Smgc	T	A	15: 91,841,398	F40Y	possibly damaging	Het
Sorcs3	G	T	19: 48,713,571	L630F	probably damaging	Het
Sphk1	A	G	11: 116,536,156	K306E	possibly damaging	Het
Spsb1	C	T	4: 149,906,844	G89D	probably damaging	Het
Stat4	G	T	1: 52,076,583	M227I	probably benign	Het
Syngr4	A	G	7: 45,887,491	V116A	possibly damaging	Het
Tacc1	T	C	8: 25,240,800	M1V	probably null	Het
Tcf7l1	T	G	6: 72,631,292	K355Q	probably damaging	Het
Tmem192	T	C	8: 64,964,236	S36P	probably damaging	Het
Top3a	G	T	11: 60,750,753	N368K	possibly damaging	Het
Tpk1	T	A	6: 43,346,793	I241F	possibly damaging	Het
Trappc10	A	G	10: 78,193,511	I1064T	possibly damaging	Het
Vmn1r18	T	A	6: 57,390,221	K116M	probably damaging	Het
Vmn2r40	A	T	7: 8,920,140	H407Q	unknown	Het
Vmn2r91	T	A	17: 18,107,545	L467H	probably damaging	Het
Wdr59	G	T	8: 111,476,101	S603R	probably damaging	Het
Wwc2	A	G	8: 47,900,791	Y103H	possibly damaging	Het
Zfp324	A	C	7: 12,970,600	K74N	probably null	Het
Zfyve16	A	G	13: 92,508,199	L1165P	probably damaging	Het

Other mutations in Gas6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Gas6	APN	8	13476171	missense	probably damaging	0.99
IGL01100:Gas6	APN	8	13475118	missense	probably benign	0.27
IGL02014:Gas6	APN	8	13468359	missense	possibly damaging	0.59
IGL02931:Gas6	APN	8	13477136	missense	probably damaging	0.98
R0023:Gas6	UTSW	8	13470344	missense	probably damaging	1.00
R0497:Gas6	UTSW	8	13470387	missense	possibly damaging	0.86
R1126:Gas6	UTSW	8	13483700	missense	probably benign	0.02
R1597:Gas6	UTSW	8	13493901	missense	probably damaging	1.00
R1601:Gas6	UTSW	8	13465786	missense	probably damaging	1.00
R1643:Gas6	UTSW	8	13465902	critical splice acceptor site	probably null
R1914:Gas6	UTSW	8	13477152	missense	probably benign
R1967:Gas6	UTSW	8	13470317	missense	probably damaging	0.98
R2012:Gas6	UTSW	8	13468266	missense	probably damaging	1.00
R4663:Gas6	UTSW	8	13470254	missense	probably damaging	1.00
R4723:Gas6	UTSW	8	13466848	missense	probably damaging	0.99
R4750:Gas6	UTSW	8	13476227	missense	probably benign	0.29
R4869:Gas6	UTSW	8	13475086	missense	possibly damaging	0.55
R5558:Gas6	UTSW	8	13466764	missense	probably null	0.03
R5706:Gas6	UTSW	8	13477098	missense	probably damaging	0.98
R5791:Gas6	UTSW	8	13470217	critical splice donor site	probably null
R6825:Gas6	UTSW	8	13483674	missense	probably benign	0.00
R7374:Gas6	UTSW	8	13474802	missense	probably damaging	0.99
R7419:Gas6	UTSW	8	13471456	missense	probably benign	0.19
R7588:Gas6	UTSW	8	13466711	missense	probably benign	0.03
R7810:Gas6	UTSW	8	13466809	missense	probably damaging	1.00
X0063:Gas6	UTSW	8	13471538	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACCCGTCCCATTATGTAC -3'
(R):5'- ACACATCCTGCAGAGTGTGG -3'

Sequencing Primer
(F):5'- ACCCGTCCCATTATGTACAGATATG -3'
(R):5'- TGGCCCTCAGCTATATGGAG -3'

Posted On

2018-08-29