Incidental Mutation 'R6767:Gm5346'
ID531986
Institutional Source Beutler Lab
Gene Symbol Gm5346
Ensembl Gene ENSMUSG00000050190
Gene Namepredicted gene 5346
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R6767 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location43624951-43627276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43626914 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 91 (T91I)
Ref Sequence ENSEMBL: ENSMUSP00000058858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056023]
Predicted Effect probably damaging
Transcript: ENSMUST00000056023
AA Change: T91I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058858
Gene: ENSMUSG00000050190
AA Change: T91I

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 159 1.3e-18 PFAM
Pfam:Reprolysin_5 205 384 1.1e-15 PFAM
Pfam:Reprolysin_4 205 393 6.2e-9 PFAM
Pfam:Reprolysin 207 397 1.7e-46 PFAM
Pfam:Reprolysin_2 223 389 5.7e-14 PFAM
Pfam:Reprolysin_3 231 352 2.6e-13 PFAM
DISIN 416 491 2.48e-38 SMART
ACR 492 628 3.4e-65 SMART
EGF 634 664 2.69e1 SMART
transmembrane domain 685 707 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 A G 12: 105,766,607 N537D probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Atp8a2 A G 14: 60,046,722 F47S probably damaging Het
Cadps T A 14: 12,550,888 T449S probably damaging Het
Ccdc33 C G 9: 58,033,244 Q489H possibly damaging Het
Cd163 T G 6: 124,304,779 S14A possibly damaging Het
Cemip G A 7: 83,998,624 L83F probably damaging Het
Chrd C T 16: 20,738,626 P665L probably benign Het
Cib4 T A 5: 30,534,245 H44L probably benign Het
Clic1 T A 17: 35,053,053 L99Q probably benign Het
Cnst C T 1: 179,609,954 T361I possibly damaging Het
Dnah6 C A 6: 73,133,608 V1613L probably benign Het
Dnajb8 T C 6: 88,222,652 S57P probably damaging Het
Dyrk3 T C 1: 131,129,590 H282R probably damaging Het
Fasn T C 11: 120,817,487 I651V possibly damaging Het
Gas6 A G 8: 13,465,784 S663P probably damaging Het
Gbp8 T C 5: 105,018,612 M284V probably benign Het
Gm12695 T C 4: 96,762,696 probably null Het
Gm17359 A T 3: 79,430,023 D46V probably benign Het
Gm6034 T A 17: 36,043,131 M1K probably null Het
Gm9376 A G 14: 118,267,236 T27A unknown Het
Grid2 A G 6: 63,931,015 D213G probably benign Het
Gsdma3 A T 11: 98,637,884 D388V possibly damaging Het
Hdac9 T A 12: 34,287,529 H716L probably damaging Het
Hist1h4b T A 13: 23,757,022 M1K probably null Het
Hivep1 T C 13: 42,154,727 S148P probably damaging Het
Kctd1 T C 18: 15,062,175 T464A possibly damaging Het
Kera A G 10: 97,609,172 D131G possibly damaging Het
Kif2c C T 4: 117,178,188 R21Q probably benign Het
Luc7l3 G T 11: 94,292,953 D453E probably damaging Het
Mrpl9 A G 3: 94,450,221 probably benign Het
Mtss1 T C 15: 58,953,581 S257G probably benign Het
N4bp2 T C 5: 65,817,187 F1467L probably damaging Het
Naa25 T C 5: 121,439,865 V945A probably damaging Het
Nrg1 T C 8: 31,917,895 I103M probably damaging Het
Olfr1369-ps1 C T 13: 21,116,057 R122C probably benign Het
Orm3 C T 4: 63,356,294 T32I probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Plch1 A T 3: 63,755,344 M246K probably damaging Het
Pld4 A C 12: 112,764,115 D144A possibly damaging Het
Prelp C A 1: 133,912,710 V345L probably benign Het
Rnf121 A G 7: 102,023,412 F238L probably damaging Het
Rnf40 A G 7: 127,596,585 K667R possibly damaging Het
Scgb1b12 A T 7: 32,334,495 N60I probably damaging Het
Serpina3n T G 12: 104,409,062 V131G probably benign Het
Slc22a21 T C 11: 53,979,502 Y119C probably damaging Het
Slc22a28 A G 19: 8,117,045 F204S probably damaging Het
Smc6 T A 12: 11,271,820 D29E possibly damaging Het
Smgc T A 15: 91,841,398 F40Y possibly damaging Het
Sorcs3 G T 19: 48,713,571 L630F probably damaging Het
Sphk1 A G 11: 116,536,156 K306E possibly damaging Het
Spsb1 C T 4: 149,906,844 G89D probably damaging Het
Stat4 G T 1: 52,076,583 M227I probably benign Het
Syngr4 A G 7: 45,887,491 V116A possibly damaging Het
Tacc1 T C 8: 25,240,800 M1V probably null Het
Tcf7l1 T G 6: 72,631,292 K355Q probably damaging Het
Tmem192 T C 8: 64,964,236 S36P probably damaging Het
Top3a G T 11: 60,750,753 N368K possibly damaging Het
Tpk1 T A 6: 43,346,793 I241F possibly damaging Het
Trappc10 A G 10: 78,193,511 I1064T possibly damaging Het
Vmn1r18 T A 6: 57,390,221 K116M probably damaging Het
Vmn2r40 A T 7: 8,920,140 H407Q unknown Het
Vmn2r91 T A 17: 18,107,545 L467H probably damaging Het
Wdr59 G T 8: 111,476,101 S603R probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp324 A C 7: 12,970,600 K74N probably null Het
Zfyve16 A G 13: 92,508,199 L1165P probably damaging Het
Other mutations in Gm5346
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Gm5346 APN 8 43625381 missense probably benign 0.12
IGL00391:Gm5346 APN 8 43625629 missense probably damaging 1.00
IGL00422:Gm5346 APN 8 43626351 missense probably damaging 1.00
IGL00664:Gm5346 APN 8 43625969 missense probably benign
IGL01095:Gm5346 APN 8 43626096 missense probably benign 0.22
IGL01113:Gm5346 APN 8 43626152 missense probably damaging 1.00
IGL01444:Gm5346 APN 8 43626433 missense probably benign 0.06
IGL01782:Gm5346 APN 8 43626735 missense probably benign 0.01
IGL01921:Gm5346 APN 8 43625511 missense probably damaging 0.96
IGL01964:Gm5346 APN 8 43626761 missense probably benign 0.00
IGL02139:Gm5346 APN 8 43625578 missense probably benign 0.01
IGL02555:Gm5346 APN 8 43625268 missense probably damaging 1.00
IGL02951:Gm5346 APN 8 43627088 missense possibly damaging 0.62
R0056:Gm5346 UTSW 8 43625503 nonsense probably null
R0218:Gm5346 UTSW 8 43626440 missense probably benign 0.00
R0530:Gm5346 UTSW 8 43626531 missense probably benign 0.00
R0925:Gm5346 UTSW 8 43626303 missense probably benign 0.11
R0927:Gm5346 UTSW 8 43625123 missense probably benign 0.00
R0975:Gm5346 UTSW 8 43625118 missense probably benign
R1300:Gm5346 UTSW 8 43626844 nonsense probably null
R1728:Gm5346 UTSW 8 43625583 missense probably damaging 1.00
R1729:Gm5346 UTSW 8 43625583 missense probably damaging 1.00
R1801:Gm5346 UTSW 8 43625917 nonsense probably null
R1869:Gm5346 UTSW 8 43625095 nonsense probably null
R1870:Gm5346 UTSW 8 43625095 nonsense probably null
R1871:Gm5346 UTSW 8 43625095 nonsense probably null
R1992:Gm5346 UTSW 8 43627139 missense probably benign 0.44
R2008:Gm5346 UTSW 8 43627037 missense probably benign 0.00
R2013:Gm5346 UTSW 8 43626405 missense possibly damaging 0.81
R2022:Gm5346 UTSW 8 43625917 nonsense probably null
R2175:Gm5346 UTSW 8 43625438 missense probably benign
R2875:Gm5346 UTSW 8 43627140 nonsense probably null
R3406:Gm5346 UTSW 8 43626052 nonsense probably null
R3845:Gm5346 UTSW 8 43626632 missense probably benign 0.00
R4033:Gm5346 UTSW 8 43626673 missense probably benign 0.28
R4072:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4074:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4075:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4076:Gm5346 UTSW 8 43626350 missense probably damaging 1.00
R4153:Gm5346 UTSW 8 43626527 missense probably benign 0.04
R4330:Gm5346 UTSW 8 43626250 missense probably benign
R4612:Gm5346 UTSW 8 43626550 missense probably benign 0.09
R4662:Gm5346 UTSW 8 43627079 missense probably benign 0.26
R5032:Gm5346 UTSW 8 43626471 missense probably damaging 1.00
R5077:Gm5346 UTSW 8 43627163 missense possibly damaging 0.79
R5504:Gm5346 UTSW 8 43625282 missense probably damaging 1.00
R5697:Gm5346 UTSW 8 43626579 missense probably damaging 1.00
R6232:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6233:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6234:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6235:Gm5346 UTSW 8 43625912 missense probably benign 0.00
R6241:Gm5346 UTSW 8 43626096 missense probably benign 0.22
R6392:Gm5346 UTSW 8 43626001 missense probably benign 0.09
R6439:Gm5346 UTSW 8 43625951 missense probably damaging 1.00
R6454:Gm5346 UTSW 8 43626808 missense probably damaging 0.96
R6455:Gm5346 UTSW 8 43626152 missense probably damaging 1.00
R6774:Gm5346 UTSW 8 43625183 missense probably benign 0.00
R6877:Gm5346 UTSW 8 43625237 missense probably benign 0.02
R6911:Gm5346 UTSW 8 43625109 missense probably benign 0.02
R7211:Gm5346 UTSW 8 43625877 missense probably damaging 1.00
R7597:Gm5346 UTSW 8 43625244 missense probably damaging 1.00
R7602:Gm5346 UTSW 8 43626666 missense probably damaging 0.99
R7797:Gm5346 UTSW 8 43626374 missense probably benign 0.04
RF001:Gm5346 UTSW 8 43626905 missense possibly damaging 0.79
Z1177:Gm5346 UTSW 8 43626546 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGTTCTGACTCCCCACTG -3'
(R):5'- AAGTACAGTAGCCTTCCAGAAG -3'

Sequencing Primer
(F):5'- GCCAGATGTTCAAATGTTGACG -3'
(R):5'- TTCCAGAAGTAGTGACACCCTTGAG -3'
Posted On2018-08-29