Incidental Mutation 'R6767:Luc7l3'
ID531995
Institutional Source Beutler Lab
Gene Symbol Luc7l3
Ensembl Gene ENSMUSG00000020863
Gene NameLUC7-like 3 (S. cerevisiae)
Synonyms3300001P08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R6767 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location94287890-94321988 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 94292953 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 453 (D453E)
Ref Sequence ENSEMBL: ENSMUSP00000021226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021226] [ENSMUST00000107820] [ENSMUST00000107821] [ENSMUST00000107822] [ENSMUST00000166312]
Predicted Effect probably damaging
Transcript: ENSMUST00000021226
AA Change: D453E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021226
Gene: ENSMUSG00000020863
AA Change: D453E

DomainStartEndE-ValueType
Pfam:LUC7 3 293 2.3e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107820
SMART Domains Protein: ENSMUSP00000103450
Gene: ENSMUSG00000020863

DomainStartEndE-ValueType
Pfam:LUC7 1 302 4.2e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107821
SMART Domains Protein: ENSMUSP00000103451
Gene: ENSMUSG00000020863

DomainStartEndE-ValueType
Pfam:LUC7 1 302 4.2e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107822
Predicted Effect unknown
Transcript: ENSMUST00000132623
AA Change: D188E
SMART Domains Protein: ENSMUSP00000131166
Gene: ENSMUSG00000020863
AA Change: D188E

DomainStartEndE-ValueType
coiled coil region 1 31 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000138369
AA Change: D55E
Predicted Effect unknown
Transcript: ENSMUST00000166312
AA Change: D453E
SMART Domains Protein: ENSMUSP00000129919
Gene: ENSMUSG00000020863
AA Change: D453E

DomainStartEndE-ValueType
Pfam:LUC7 1 300 7.9e-72 PFAM
Meta Mutation Damage Score 0.1102 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an N-terminal half that contains cysteine/histidine motifs and leucine zipper-like repeats, and the C-terminal half is rich in arginine and glutamate residues (RE domain) and arginine and serine residues (RS domain). This protein localizes with a speckled pattern in the nucleus, and could be involved in the formation of splicesome via the RE and RS domains. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 A G 12: 105,766,607 N537D probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Atp8a2 A G 14: 60,046,722 F47S probably damaging Het
Cadps T A 14: 12,550,888 T449S probably damaging Het
Ccdc33 C G 9: 58,033,244 Q489H possibly damaging Het
Cd163 T G 6: 124,304,779 S14A possibly damaging Het
Cemip G A 7: 83,998,624 L83F probably damaging Het
Chrd C T 16: 20,738,626 P665L probably benign Het
Cib4 T A 5: 30,534,245 H44L probably benign Het
Clic1 T A 17: 35,053,053 L99Q probably benign Het
Cnst C T 1: 179,609,954 T361I possibly damaging Het
Dnah6 C A 6: 73,133,608 V1613L probably benign Het
Dnajb8 T C 6: 88,222,652 S57P probably damaging Het
Dyrk3 T C 1: 131,129,590 H282R probably damaging Het
Fasn T C 11: 120,817,487 I651V possibly damaging Het
Gas6 A G 8: 13,465,784 S663P probably damaging Het
Gbp8 T C 5: 105,018,612 M284V probably benign Het
Gm12695 T C 4: 96,762,696 probably null Het
Gm17359 A T 3: 79,430,023 D46V probably benign Het
Gm5346 G A 8: 43,626,914 T91I probably damaging Het
Gm6034 T A 17: 36,043,131 M1K probably null Het
Gm9376 A G 14: 118,267,236 T27A unknown Het
Grid2 A G 6: 63,931,015 D213G probably benign Het
Gsdma3 A T 11: 98,637,884 D388V possibly damaging Het
Hdac9 T A 12: 34,287,529 H716L probably damaging Het
Hist1h4b T A 13: 23,757,022 M1K probably null Het
Hivep1 T C 13: 42,154,727 S148P probably damaging Het
Kctd1 T C 18: 15,062,175 T464A possibly damaging Het
Kera A G 10: 97,609,172 D131G possibly damaging Het
Kif2c C T 4: 117,178,188 R21Q probably benign Het
Mrpl9 A G 3: 94,450,221 probably benign Het
Mtss1 T C 15: 58,953,581 S257G probably benign Het
N4bp2 T C 5: 65,817,187 F1467L probably damaging Het
Naa25 T C 5: 121,439,865 V945A probably damaging Het
Nrg1 T C 8: 31,917,895 I103M probably damaging Het
Olfr1369-ps1 C T 13: 21,116,057 R122C probably benign Het
Orm3 C T 4: 63,356,294 T32I probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Plch1 A T 3: 63,755,344 M246K probably damaging Het
Pld4 A C 12: 112,764,115 D144A possibly damaging Het
Prelp C A 1: 133,912,710 V345L probably benign Het
Rnf121 A G 7: 102,023,412 F238L probably damaging Het
Rnf40 A G 7: 127,596,585 K667R possibly damaging Het
Scgb1b12 A T 7: 32,334,495 N60I probably damaging Het
Serpina3n T G 12: 104,409,062 V131G probably benign Het
Slc22a21 T C 11: 53,979,502 Y119C probably damaging Het
Slc22a28 A G 19: 8,117,045 F204S probably damaging Het
Smc6 T A 12: 11,271,820 D29E possibly damaging Het
Smgc T A 15: 91,841,398 F40Y possibly damaging Het
Sorcs3 G T 19: 48,713,571 L630F probably damaging Het
Sphk1 A G 11: 116,536,156 K306E possibly damaging Het
Spsb1 C T 4: 149,906,844 G89D probably damaging Het
Stat4 G T 1: 52,076,583 M227I probably benign Het
Syngr4 A G 7: 45,887,491 V116A possibly damaging Het
Tacc1 T C 8: 25,240,800 M1V probably null Het
Tcf7l1 T G 6: 72,631,292 K355Q probably damaging Het
Tmem192 T C 8: 64,964,236 S36P probably damaging Het
Top3a G T 11: 60,750,753 N368K possibly damaging Het
Tpk1 T A 6: 43,346,793 I241F possibly damaging Het
Trappc10 A G 10: 78,193,511 I1064T possibly damaging Het
Vmn1r18 T A 6: 57,390,221 K116M probably damaging Het
Vmn2r40 A T 7: 8,920,140 H407Q unknown Het
Vmn2r91 T A 17: 18,107,545 L467H probably damaging Het
Wdr59 G T 8: 111,476,101 S603R probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp324 A C 7: 12,970,600 K74N probably null Het
Zfyve16 A G 13: 92,508,199 L1165P probably damaging Het
Other mutations in Luc7l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Luc7l3 APN 11 94303942 missense probably benign 0.43
IGL02138:Luc7l3 APN 11 94303966 missense probably benign 0.00
IGL02318:Luc7l3 APN 11 94292993 missense probably benign 0.05
IGL02479:Luc7l3 APN 11 94296909 unclassified probably benign
IGL02563:Luc7l3 APN 11 94300068 splice site probably null
veritas UTSW 11 94292953 missense probably damaging 0.98
R0096:Luc7l3 UTSW 11 94301494 splice site probably benign
R0096:Luc7l3 UTSW 11 94301494 splice site probably benign
R1706:Luc7l3 UTSW 11 94297756 splice site probably benign
R3803:Luc7l3 UTSW 11 94293166 utr 3 prime probably benign
R4260:Luc7l3 UTSW 11 94296050 unclassified probably benign
R4647:Luc7l3 UTSW 11 94309641 missense probably damaging 1.00
R5153:Luc7l3 UTSW 11 94295980 unclassified probably benign
R5179:Luc7l3 UTSW 11 94300053 missense possibly damaging 0.92
R5591:Luc7l3 UTSW 11 94293234 unclassified probably benign
R6912:Luc7l3 UTSW 11 94309636 missense probably damaging 0.97
R7168:Luc7l3 UTSW 11 94299984 missense unknown
R7541:Luc7l3 UTSW 11 94295965 missense unknown
Z1177:Luc7l3 UTSW 11 94321775 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGTTTCTGCCAATGTACCAACAC -3'
(R):5'- CATTAAATCTGAAGGTGACACTCAG -3'

Sequencing Primer
(F):5'- TTCTGCCAATGTACCAACACAAGATG -3'
(R):5'- CACTCAGTCCAATTAAAACTGATCTG -3'
Posted On2018-08-29