Incidental Mutation 'R6767:Sphk1'
ID531997
Institutional Source Beutler Lab
Gene Symbol Sphk1
Ensembl Gene ENSMUSG00000061878
Gene Namesphingosine kinase 1
Synonyms1110006G24Rik, SK1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6767 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116530925-116536674 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116536156 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 306 (K306E)
Ref Sequence ENSEMBL: ENSMUSP00000097775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063396] [ENSMUST00000063446] [ENSMUST00000082152] [ENSMUST00000100201] [ENSMUST00000106386] [ENSMUST00000106387] [ENSMUST00000106388] [ENSMUST00000124682] [ENSMUST00000138840] [ENSMUST00000141798] [ENSMUST00000145737] [ENSMUST00000154034] [ENSMUST00000155102]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063396
AA Change: K307E

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064743
Gene: ENSMUSG00000061878
AA Change: K307E

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000063446
AA Change: K307E

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067865
Gene: ENSMUSG00000061878
AA Change: K307E

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082152
SMART Domains Protein: ENSMUSP00000080791
Gene: ENSMUSG00000020802

DomainStartEndE-ValueType
low complexity region 2 47 N/A INTRINSIC
low complexity region 79 110 N/A INTRINSIC
low complexity region 289 298 N/A INTRINSIC
low complexity region 379 391 N/A INTRINSIC
low complexity region 470 505 N/A INTRINSIC
low complexity region 516 528 N/A INTRINSIC
low complexity region 705 712 N/A INTRINSIC
low complexity region 715 737 N/A INTRINSIC
coiled coil region 845 879 N/A INTRINSIC
UBCc 953 1110 2.23e-16 SMART
Blast:UBCc 1201 1274 1e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000100201
AA Change: K306E

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097775
Gene: ENSMUSG00000061878
AA Change: K306E

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
low complexity region 256 262 N/A INTRINSIC
low complexity region 367 381 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106386
AA Change: K307E

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101994
Gene: ENSMUSG00000061878
AA Change: K307E

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106387
AA Change: K307E

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101995
Gene: ENSMUSG00000061878
AA Change: K307E

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106388
AA Change: K307E

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101996
Gene: ENSMUSG00000061878
AA Change: K307E

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
low complexity region 257 263 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124682
SMART Domains Protein: ENSMUSP00000116055
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 16 153 1.19e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138840
SMART Domains Protein: ENSMUSP00000121064
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000141798
AA Change: K313E

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131010
Gene: ENSMUSG00000061878
AA Change: K313E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
DAGKc 22 159 1.19e-8 SMART
low complexity region 263 269 N/A INTRINSIC
low complexity region 374 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145737
SMART Domains Protein: ENSMUSP00000114622
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154034
SMART Domains Protein: ENSMUSP00000121219
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
DAGKc 15 152 1.19e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155102
SMART Domains Protein: ENSMUSP00000114819
Gene: ENSMUSG00000061878

DomainStartEndE-ValueType
Pfam:DAGK_cat 16 116 4.6e-27 PFAM
Meta Mutation Damage Score 0.0807 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: This gene encodes a kinase that phosphorylates sphingosine into sphingosine-1-phosphate, which is involved in cell differentiation, motility, and apoptosis. The encoded protein plays a role in maintaining cellular levels of sphingosine-1-phosphate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous null mice are viable, fertile, and without any obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 A G 12: 105,766,607 N537D probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Atp8a2 A G 14: 60,046,722 F47S probably damaging Het
Cadps T A 14: 12,550,888 T449S probably damaging Het
Ccdc33 C G 9: 58,033,244 Q489H possibly damaging Het
Cd163 T G 6: 124,304,779 S14A possibly damaging Het
Cemip G A 7: 83,998,624 L83F probably damaging Het
Chrd C T 16: 20,738,626 P665L probably benign Het
Cib4 T A 5: 30,534,245 H44L probably benign Het
Clic1 T A 17: 35,053,053 L99Q probably benign Het
Cnst C T 1: 179,609,954 T361I possibly damaging Het
Dnah6 C A 6: 73,133,608 V1613L probably benign Het
Dnajb8 T C 6: 88,222,652 S57P probably damaging Het
Dyrk3 T C 1: 131,129,590 H282R probably damaging Het
Fasn T C 11: 120,817,487 I651V possibly damaging Het
Gas6 A G 8: 13,465,784 S663P probably damaging Het
Gbp8 T C 5: 105,018,612 M284V probably benign Het
Gm12695 T C 4: 96,762,696 probably null Het
Gm17359 A T 3: 79,430,023 D46V probably benign Het
Gm5346 G A 8: 43,626,914 T91I probably damaging Het
Gm6034 T A 17: 36,043,131 M1K probably null Het
Gm9376 A G 14: 118,267,236 T27A unknown Het
Grid2 A G 6: 63,931,015 D213G probably benign Het
Gsdma3 A T 11: 98,637,884 D388V possibly damaging Het
Hdac9 T A 12: 34,287,529 H716L probably damaging Het
Hist1h4b T A 13: 23,757,022 M1K probably null Het
Hivep1 T C 13: 42,154,727 S148P probably damaging Het
Kctd1 T C 18: 15,062,175 T464A possibly damaging Het
Kera A G 10: 97,609,172 D131G possibly damaging Het
Kif2c C T 4: 117,178,188 R21Q probably benign Het
Luc7l3 G T 11: 94,292,953 D453E probably damaging Het
Mrpl9 A G 3: 94,450,221 probably benign Het
Mtss1 T C 15: 58,953,581 S257G probably benign Het
N4bp2 T C 5: 65,817,187 F1467L probably damaging Het
Naa25 T C 5: 121,439,865 V945A probably damaging Het
Nrg1 T C 8: 31,917,895 I103M probably damaging Het
Olfr1369-ps1 C T 13: 21,116,057 R122C probably benign Het
Orm3 C T 4: 63,356,294 T32I probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Plch1 A T 3: 63,755,344 M246K probably damaging Het
Pld4 A C 12: 112,764,115 D144A possibly damaging Het
Prelp C A 1: 133,912,710 V345L probably benign Het
Rnf121 A G 7: 102,023,412 F238L probably damaging Het
Rnf40 A G 7: 127,596,585 K667R possibly damaging Het
Scgb1b12 A T 7: 32,334,495 N60I probably damaging Het
Serpina3n T G 12: 104,409,062 V131G probably benign Het
Slc22a21 T C 11: 53,979,502 Y119C probably damaging Het
Slc22a28 A G 19: 8,117,045 F204S probably damaging Het
Smc6 T A 12: 11,271,820 D29E possibly damaging Het
Smgc T A 15: 91,841,398 F40Y possibly damaging Het
Sorcs3 G T 19: 48,713,571 L630F probably damaging Het
Spsb1 C T 4: 149,906,844 G89D probably damaging Het
Stat4 G T 1: 52,076,583 M227I probably benign Het
Syngr4 A G 7: 45,887,491 V116A possibly damaging Het
Tacc1 T C 8: 25,240,800 M1V probably null Het
Tcf7l1 T G 6: 72,631,292 K355Q probably damaging Het
Tmem192 T C 8: 64,964,236 S36P probably damaging Het
Top3a G T 11: 60,750,753 N368K possibly damaging Het
Tpk1 T A 6: 43,346,793 I241F possibly damaging Het
Trappc10 A G 10: 78,193,511 I1064T possibly damaging Het
Vmn1r18 T A 6: 57,390,221 K116M probably damaging Het
Vmn2r40 A T 7: 8,920,140 H407Q unknown Het
Vmn2r91 T A 17: 18,107,545 L467H probably damaging Het
Wdr59 G T 8: 111,476,101 S603R probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp324 A C 7: 12,970,600 K74N probably null Het
Zfyve16 A G 13: 92,508,199 L1165P probably damaging Het
Other mutations in Sphk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0040:Sphk1 UTSW 11 116535065 splice site probably benign
R0565:Sphk1 UTSW 11 116536358 unclassified probably benign
R1307:Sphk1 UTSW 11 116536102 missense probably benign 0.09
R1635:Sphk1 UTSW 11 116535770 missense probably damaging 1.00
R1940:Sphk1 UTSW 11 116535850 missense probably benign 0.00
R4685:Sphk1 UTSW 11 116535280 missense probably damaging 1.00
R5440:Sphk1 UTSW 11 116534888 missense possibly damaging 0.54
R5621:Sphk1 UTSW 11 116536366 unclassified probably benign
R7150:Sphk1 UTSW 11 116535081 missense probably benign 0.07
R7207:Sphk1 UTSW 11 116535764 missense probably damaging 1.00
R7758:Sphk1 UTSW 11 116536237 missense possibly damaging 0.75
R8084:Sphk1 UTSW 11 116535078 critical splice acceptor site probably null
RF018:Sphk1 UTSW 11 116534945 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGGTACCAGAACAGGACTTCG -3'
(R):5'- ACAAAGGCACAGAGTTATGGTTC -3'

Sequencing Primer
(F):5'- ACTTCGTCCTGGTGCTGG -3'
(R):5'- AAAGGCACAGAGTTATGGTTCTTCTG -3'
Posted On2018-08-29