Incidental Mutation 'R6767:Pld4'
ID532002
Institutional Source Beutler Lab
Gene Symbol Pld4
Ensembl Gene ENSMUSG00000052160
Gene Namephospholipase D family, member 4
Synonymsthss
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6767 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location112760655-112768990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 112764115 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 144 (D144A)
Ref Sequence ENSEMBL: ENSMUSP00000067002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063888]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063888
AA Change: D144A

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000067002
Gene: ENSMUSG00000052160
AA Change: D144A

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
low complexity region 113 124 N/A INTRINSIC
PLDc 207 234 1.64e-10 SMART
Pfam:PLDc_3 237 414 5.5e-41 PFAM
PLDc 421 447 4.66e-6 SMART
Meta Mutation Damage Score 0.7484 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: A spontaneous mutation that introduces a stop codon at residue 46 of 503 results in smaller body size and thin fur. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 A G 12: 105,766,607 N537D probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Atp8a2 A G 14: 60,046,722 F47S probably damaging Het
Cadps T A 14: 12,550,888 T449S probably damaging Het
Ccdc33 C G 9: 58,033,244 Q489H possibly damaging Het
Cd163 T G 6: 124,304,779 S14A possibly damaging Het
Cemip G A 7: 83,998,624 L83F probably damaging Het
Chrd C T 16: 20,738,626 P665L probably benign Het
Cib4 T A 5: 30,534,245 H44L probably benign Het
Clic1 T A 17: 35,053,053 L99Q probably benign Het
Cnst C T 1: 179,609,954 T361I possibly damaging Het
Dnah6 C A 6: 73,133,608 V1613L probably benign Het
Dnajb8 T C 6: 88,222,652 S57P probably damaging Het
Dyrk3 T C 1: 131,129,590 H282R probably damaging Het
Fasn T C 11: 120,817,487 I651V possibly damaging Het
Gas6 A G 8: 13,465,784 S663P probably damaging Het
Gbp8 T C 5: 105,018,612 M284V probably benign Het
Gm12695 T C 4: 96,762,696 probably null Het
Gm17359 A T 3: 79,430,023 D46V probably benign Het
Gm5346 G A 8: 43,626,914 T91I probably damaging Het
Gm6034 T A 17: 36,043,131 M1K probably null Het
Gm9376 A G 14: 118,267,236 T27A unknown Het
Grid2 A G 6: 63,931,015 D213G probably benign Het
Gsdma3 A T 11: 98,637,884 D388V possibly damaging Het
Hdac9 T A 12: 34,287,529 H716L probably damaging Het
Hist1h4b T A 13: 23,757,022 M1K probably null Het
Hivep1 T C 13: 42,154,727 S148P probably damaging Het
Kctd1 T C 18: 15,062,175 T464A possibly damaging Het
Kera A G 10: 97,609,172 D131G possibly damaging Het
Kif2c C T 4: 117,178,188 R21Q probably benign Het
Luc7l3 G T 11: 94,292,953 D453E probably damaging Het
Mrpl9 A G 3: 94,450,221 probably benign Het
Mtss1 T C 15: 58,953,581 S257G probably benign Het
N4bp2 T C 5: 65,817,187 F1467L probably damaging Het
Naa25 T C 5: 121,439,865 V945A probably damaging Het
Nrg1 T C 8: 31,917,895 I103M probably damaging Het
Olfr1369-ps1 C T 13: 21,116,057 R122C probably benign Het
Orm3 C T 4: 63,356,294 T32I probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Plch1 A T 3: 63,755,344 M246K probably damaging Het
Prelp C A 1: 133,912,710 V345L probably benign Het
Rnf121 A G 7: 102,023,412 F238L probably damaging Het
Rnf40 A G 7: 127,596,585 K667R possibly damaging Het
Scgb1b12 A T 7: 32,334,495 N60I probably damaging Het
Serpina3n T G 12: 104,409,062 V131G probably benign Het
Slc22a21 T C 11: 53,979,502 Y119C probably damaging Het
Slc22a28 A G 19: 8,117,045 F204S probably damaging Het
Smc6 T A 12: 11,271,820 D29E possibly damaging Het
Smgc T A 15: 91,841,398 F40Y possibly damaging Het
Sorcs3 G T 19: 48,713,571 L630F probably damaging Het
Sphk1 A G 11: 116,536,156 K306E possibly damaging Het
Spsb1 C T 4: 149,906,844 G89D probably damaging Het
Stat4 G T 1: 52,076,583 M227I probably benign Het
Syngr4 A G 7: 45,887,491 V116A possibly damaging Het
Tacc1 T C 8: 25,240,800 M1V probably null Het
Tcf7l1 T G 6: 72,631,292 K355Q probably damaging Het
Tmem192 T C 8: 64,964,236 S36P probably damaging Het
Top3a G T 11: 60,750,753 N368K possibly damaging Het
Tpk1 T A 6: 43,346,793 I241F possibly damaging Het
Trappc10 A G 10: 78,193,511 I1064T possibly damaging Het
Vmn1r18 T A 6: 57,390,221 K116M probably damaging Het
Vmn2r40 A T 7: 8,920,140 H407Q unknown Het
Vmn2r91 T A 17: 18,107,545 L467H probably damaging Het
Wdr59 G T 8: 111,476,101 S603R probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp324 A C 7: 12,970,600 K74N probably null Het
Zfyve16 A G 13: 92,508,199 L1165P probably damaging Het
Other mutations in Pld4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Pld4 APN 12 112763491 missense probably benign 0.01
IGL01839:Pld4 APN 12 112765079 missense probably damaging 1.00
IGL01954:Pld4 APN 12 112767921 critical splice donor site probably null
IGL02253:Pld4 APN 12 112766707 missense probably damaging 1.00
IGL03149:Pld4 APN 12 112766829 missense probably benign 0.00
IGL03278:Pld4 APN 12 112766731 missense probably damaging 0.98
IGL03349:Pld4 APN 12 112767879 missense probably benign 0.01
Lipodicum UTSW 12 112765064 missense probably damaging 1.00
PIT4403001:Pld4 UTSW 12 112767822 missense probably damaging 1.00
PIT4468001:Pld4 UTSW 12 112767822 missense probably damaging 1.00
R0052:Pld4 UTSW 12 112767857 missense probably benign 0.03
R1078:Pld4 UTSW 12 112763442 missense probably benign
R1756:Pld4 UTSW 12 112763392 splice site probably null
R2006:Pld4 UTSW 12 112768489 missense possibly damaging 0.89
R2037:Pld4 UTSW 12 112768558 missense probably damaging 1.00
R3738:Pld4 UTSW 12 112768035 missense probably benign 0.07
R4630:Pld4 UTSW 12 112765064 missense probably damaging 1.00
R4911:Pld4 UTSW 12 112764517 missense probably benign 0.01
R5008:Pld4 UTSW 12 112768050 missense possibly damaging 0.89
R5263:Pld4 UTSW 12 112765031 missense probably damaging 1.00
R5310:Pld4 UTSW 12 112768612 missense probably damaging 1.00
R5386:Pld4 UTSW 12 112763988 nonsense probably null
R5513:Pld4 UTSW 12 112762554 missense probably benign
R5788:Pld4 UTSW 12 112764117 missense probably benign
R6085:Pld4 UTSW 12 112766886 missense probably benign 0.01
R6157:Pld4 UTSW 12 112768101 missense probably damaging 1.00
R6702:Pld4 UTSW 12 112765051 missense probably damaging 1.00
R6962:Pld4 UTSW 12 112766854 missense probably benign 0.00
R7864:Pld4 UTSW 12 112765123 missense probably damaging 1.00
R8792:Pld4 UTSW 12 112763490 missense probably benign 0.00
R8826:Pld4 UTSW 12 112766776 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATACAGCTTGGTCTGCCCTG -3'
(R):5'- AAAAGATGACATCATGCATGCG -3'

Sequencing Primer
(F):5'- GGGTTCTGTCCCTAGGCTC -3'
(R):5'- TGCTGCTGTCCCAAGAGTCAC -3'
Posted On2018-08-29