Incidental Mutation 'R6767:Mtss1'
ID532010
Institutional Source Beutler Lab
Gene Symbol Mtss1
Ensembl Gene ENSMUSG00000022353
Gene Namemetastasis suppressor 1
SynonymsD130001D01Rik, 2310003N14Rik, MIM
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.772) question?
Stock #R6767 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location58941234-59082005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58953581 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 257 (S257G)
Ref Sequence ENSEMBL: ENSMUSP00000079239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080371]
Predicted Effect probably benign
Transcript: ENSMUST00000080371
AA Change: S257G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000079239
Gene: ENSMUSG00000022353
AA Change: S257G

DomainStartEndE-ValueType
Pfam:IMD 16 241 2.1e-107 PFAM
low complexity region 257 309 N/A INTRINSIC
low complexity region 443 459 N/A INTRINSIC
low complexity region 612 628 N/A INTRINSIC
WH2 731 748 1.36e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227045
AA Change: S1G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228067
AA Change: S60G
Meta Mutation Damage Score 0.0748 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (67/67)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit polycystic kidney in 50% of mice by 5 months of age. Mouse embryonic fibroblasts from mice homozygous for a different gene trap allele exhibit altered cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 A G 12: 105,766,607 N537D probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Atp8a2 A G 14: 60,046,722 F47S probably damaging Het
Cadps T A 14: 12,550,888 T449S probably damaging Het
Ccdc33 C G 9: 58,033,244 Q489H possibly damaging Het
Cd163 T G 6: 124,304,779 S14A possibly damaging Het
Cemip G A 7: 83,998,624 L83F probably damaging Het
Chrd C T 16: 20,738,626 P665L probably benign Het
Cib4 T A 5: 30,534,245 H44L probably benign Het
Clic1 T A 17: 35,053,053 L99Q probably benign Het
Cnst C T 1: 179,609,954 T361I possibly damaging Het
Dnah6 C A 6: 73,133,608 V1613L probably benign Het
Dnajb8 T C 6: 88,222,652 S57P probably damaging Het
Dyrk3 T C 1: 131,129,590 H282R probably damaging Het
Fasn T C 11: 120,817,487 I651V possibly damaging Het
Gas6 A G 8: 13,465,784 S663P probably damaging Het
Gbp8 T C 5: 105,018,612 M284V probably benign Het
Gm12695 T C 4: 96,762,696 probably null Het
Gm17359 A T 3: 79,430,023 D46V probably benign Het
Gm5346 G A 8: 43,626,914 T91I probably damaging Het
Gm6034 T A 17: 36,043,131 M1K probably null Het
Gm9376 A G 14: 118,267,236 T27A unknown Het
Grid2 A G 6: 63,931,015 D213G probably benign Het
Gsdma3 A T 11: 98,637,884 D388V possibly damaging Het
Hdac9 T A 12: 34,287,529 H716L probably damaging Het
Hist1h4b T A 13: 23,757,022 M1K probably null Het
Hivep1 T C 13: 42,154,727 S148P probably damaging Het
Kctd1 T C 18: 15,062,175 T464A possibly damaging Het
Kera A G 10: 97,609,172 D131G possibly damaging Het
Kif2c C T 4: 117,178,188 R21Q probably benign Het
Luc7l3 G T 11: 94,292,953 D453E probably damaging Het
Mrpl9 A G 3: 94,450,221 probably benign Het
N4bp2 T C 5: 65,817,187 F1467L probably damaging Het
Naa25 T C 5: 121,439,865 V945A probably damaging Het
Nrg1 T C 8: 31,917,895 I103M probably damaging Het
Olfr1369-ps1 C T 13: 21,116,057 R122C probably benign Het
Orm3 C T 4: 63,356,294 T32I probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Plch1 A T 3: 63,755,344 M246K probably damaging Het
Pld4 A C 12: 112,764,115 D144A possibly damaging Het
Prelp C A 1: 133,912,710 V345L probably benign Het
Rnf121 A G 7: 102,023,412 F238L probably damaging Het
Rnf40 A G 7: 127,596,585 K667R possibly damaging Het
Scgb1b12 A T 7: 32,334,495 N60I probably damaging Het
Serpina3n T G 12: 104,409,062 V131G probably benign Het
Slc22a21 T C 11: 53,979,502 Y119C probably damaging Het
Slc22a28 A G 19: 8,117,045 F204S probably damaging Het
Smc6 T A 12: 11,271,820 D29E possibly damaging Het
Smgc T A 15: 91,841,398 F40Y possibly damaging Het
Sorcs3 G T 19: 48,713,571 L630F probably damaging Het
Sphk1 A G 11: 116,536,156 K306E possibly damaging Het
Spsb1 C T 4: 149,906,844 G89D probably damaging Het
Stat4 G T 1: 52,076,583 M227I probably benign Het
Syngr4 A G 7: 45,887,491 V116A possibly damaging Het
Tacc1 T C 8: 25,240,800 M1V probably null Het
Tcf7l1 T G 6: 72,631,292 K355Q probably damaging Het
Tmem192 T C 8: 64,964,236 S36P probably damaging Het
Top3a G T 11: 60,750,753 N368K possibly damaging Het
Tpk1 T A 6: 43,346,793 I241F possibly damaging Het
Trappc10 A G 10: 78,193,511 I1064T possibly damaging Het
Vmn1r18 T A 6: 57,390,221 K116M probably damaging Het
Vmn2r40 A T 7: 8,920,140 H407Q unknown Het
Vmn2r91 T A 17: 18,107,545 L467H probably damaging Het
Wdr59 G T 8: 111,476,101 S603R probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp324 A C 7: 12,970,600 K74N probably null Het
Zfyve16 A G 13: 92,508,199 L1165P probably damaging Het
Other mutations in Mtss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Mtss1 APN 15 58951468 critical splice donor site probably null
IGL00693:Mtss1 APN 15 58944124 missense probably damaging 1.00
IGL00817:Mtss1 APN 15 58943632 unclassified probably null
IGL00923:Mtss1 APN 15 58943499 missense possibly damaging 0.80
IGL01704:Mtss1 APN 15 59055083 missense possibly damaging 0.91
IGL02257:Mtss1 APN 15 58956545 missense probably damaging 1.00
IGL02632:Mtss1 APN 15 58944015 missense probably damaging 0.99
IGL02829:Mtss1 APN 15 59058428 splice site probably benign
IGL02838:Mtss1 APN 15 59081515 missense probably benign 0.06
IGL02968:Mtss1 APN 15 58956515 missense possibly damaging 0.77
IGL03012:Mtss1 APN 15 59058400 missense probably damaging 0.97
IGL03022:Mtss1 APN 15 58953590 missense probably damaging 1.00
R0193:Mtss1 UTSW 15 58944017 missense probably damaging 0.99
R0498:Mtss1 UTSW 15 58945437 missense probably damaging 1.00
R0510:Mtss1 UTSW 15 58956538 missense probably benign 0.07
R0655:Mtss1 UTSW 15 59081502 missense probably damaging 0.99
R1183:Mtss1 UTSW 15 58971048 missense probably damaging 0.97
R1428:Mtss1 UTSW 15 58947390 missense probably benign 0.04
R1503:Mtss1 UTSW 15 58951672 missense probably damaging 1.00
R1597:Mtss1 UTSW 15 58943711 missense probably damaging 1.00
R1795:Mtss1 UTSW 15 59058400 missense possibly damaging 0.92
R3689:Mtss1 UTSW 15 58953536 missense probably damaging 1.00
R4724:Mtss1 UTSW 15 59081518 missense probably damaging 0.98
R4811:Mtss1 UTSW 15 58944073 missense probably damaging 1.00
R4968:Mtss1 UTSW 15 58943918 missense probably damaging 1.00
R5082:Mtss1 UTSW 15 58971019 missense probably damaging 1.00
R5783:Mtss1 UTSW 15 58943524 missense probably benign 0.05
R6253:Mtss1 UTSW 15 58943719 missense probably benign 0.02
R6890:Mtss1 UTSW 15 58951659 missense probably damaging 1.00
R7001:Mtss1 UTSW 15 58948334 intron probably benign
R7502:Mtss1 UTSW 15 58948361 missense probably damaging 0.96
R7722:Mtss1 UTSW 15 59055086 missense probably damaging 1.00
R7867:Mtss1 UTSW 15 58971009 missense possibly damaging 0.82
R7888:Mtss1 UTSW 15 58972524 missense probably damaging 1.00
R7950:Mtss1 UTSW 15 58971009 missense possibly damaging 0.82
R7971:Mtss1 UTSW 15 58972524 missense probably damaging 1.00
Z1177:Mtss1 UTSW 15 58945420 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTAGTGGTGGGGAATGAC -3'
(R):5'- TTGCTCGTCTCTGAAGGACTG -3'

Sequencing Primer
(F):5'- AGAGTGAGTACATTCTTCGCC -3'
(R):5'- TCGTCTCTGAAGGACTGTGACAC -3'
Posted On2018-08-29