Incidental Mutation 'R6767:Smgc'
ID532011
Institutional Source Beutler Lab
Gene Symbol Smgc
Ensembl Gene ENSMUSG00000047295
Gene Namesubmandibular gland protein C
SynonymsSfc21, DXImx49e, 2310010P21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R6767 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location91838265-91861438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91841398 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 40 (F40Y)
Ref Sequence ENSEMBL: ENSMUSP00000097866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088555] [ENSMUST00000100293] [ENSMUST00000109276] [ENSMUST00000109277] [ENSMUST00000126508] [ENSMUST00000130014]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088555
AA Change: F40Y

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000085915
Gene: ENSMUSG00000047295
AA Change: F40Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
internal_repeat_1 55 224 2.76e-22 PROSPERO
low complexity region 225 235 N/A INTRINSIC
low complexity region 256 270 N/A INTRINSIC
internal_repeat_1 294 464 2.76e-22 PROSPERO
low complexity region 563 574 N/A INTRINSIC
low complexity region 609 626 N/A INTRINSIC
low complexity region 652 667 N/A INTRINSIC
low complexity region 677 701 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100293
AA Change: F40Y

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097866
Gene: ENSMUSG00000047295
AA Change: F40Y

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
internal_repeat_2 32 180 5.58e-9 PROSPERO
internal_repeat_1 55 224 1.24e-22 PROSPERO
low complexity region 225 235 N/A INTRINSIC
low complexity region 256 270 N/A INTRINSIC
internal_repeat_1 294 464 1.24e-22 PROSPERO
internal_repeat_2 420 569 5.58e-9 PROSPERO
low complexity region 576 593 N/A INTRINSIC
low complexity region 619 634 N/A INTRINSIC
low complexity region 644 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109276
SMART Domains Protein: ENSMUSP00000104899
Gene: ENSMUSG00000047295

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 76 91 N/A INTRINSIC
low complexity region 101 125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109277
SMART Domains Protein: ENSMUSP00000104900
Gene: ENSMUSG00000047295

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
low complexity region 72 96 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126508
SMART Domains Protein: ENSMUSP00000120826
Gene: ENSMUSG00000047295

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130014
SMART Domains Protein: ENSMUSP00000118530
Gene: ENSMUSG00000047295

DomainStartEndE-ValueType
internal_repeat_1 113 156 5.82e-16 PROSPERO
low complexity region 179 189 N/A INTRINSIC
low complexity region 210 224 N/A INTRINSIC
internal_repeat_1 233 276 5.82e-16 PROSPERO
low complexity region 304 319 N/A INTRINSIC
low complexity region 329 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136172
SMART Domains Protein: ENSMUSP00000119575
Gene: ENSMUSG00000047295

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
low complexity region 155 166 N/A INTRINSIC
low complexity region 201 218 N/A INTRINSIC
low complexity region 244 259 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak7 A G 12: 105,766,607 N537D probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Atp8a2 A G 14: 60,046,722 F47S probably damaging Het
Cadps T A 14: 12,550,888 T449S probably damaging Het
Ccdc33 C G 9: 58,033,244 Q489H possibly damaging Het
Cd163 T G 6: 124,304,779 S14A possibly damaging Het
Cemip G A 7: 83,998,624 L83F probably damaging Het
Chrd C T 16: 20,738,626 P665L probably benign Het
Cib4 T A 5: 30,534,245 H44L probably benign Het
Clic1 T A 17: 35,053,053 L99Q probably benign Het
Cnst C T 1: 179,609,954 T361I possibly damaging Het
Dnah6 C A 6: 73,133,608 V1613L probably benign Het
Dnajb8 T C 6: 88,222,652 S57P probably damaging Het
Dyrk3 T C 1: 131,129,590 H282R probably damaging Het
Fasn T C 11: 120,817,487 I651V possibly damaging Het
Gas6 A G 8: 13,465,784 S663P probably damaging Het
Gbp8 T C 5: 105,018,612 M284V probably benign Het
Gm12695 T C 4: 96,762,696 probably null Het
Gm17359 A T 3: 79,430,023 D46V probably benign Het
Gm5346 G A 8: 43,626,914 T91I probably damaging Het
Gm6034 T A 17: 36,043,131 M1K probably null Het
Gm9376 A G 14: 118,267,236 T27A unknown Het
Grid2 A G 6: 63,931,015 D213G probably benign Het
Gsdma3 A T 11: 98,637,884 D388V possibly damaging Het
Hdac9 T A 12: 34,287,529 H716L probably damaging Het
Hist1h4b T A 13: 23,757,022 M1K probably null Het
Hivep1 T C 13: 42,154,727 S148P probably damaging Het
Kctd1 T C 18: 15,062,175 T464A possibly damaging Het
Kera A G 10: 97,609,172 D131G possibly damaging Het
Kif2c C T 4: 117,178,188 R21Q probably benign Het
Luc7l3 G T 11: 94,292,953 D453E probably damaging Het
Mrpl9 A G 3: 94,450,221 probably benign Het
Mtss1 T C 15: 58,953,581 S257G probably benign Het
N4bp2 T C 5: 65,817,187 F1467L probably damaging Het
Naa25 T C 5: 121,439,865 V945A probably damaging Het
Nrg1 T C 8: 31,917,895 I103M probably damaging Het
Olfr1369-ps1 C T 13: 21,116,057 R122C probably benign Het
Orm3 C T 4: 63,356,294 T32I probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Plch1 A T 3: 63,755,344 M246K probably damaging Het
Pld4 A C 12: 112,764,115 D144A possibly damaging Het
Prelp C A 1: 133,912,710 V345L probably benign Het
Rnf121 A G 7: 102,023,412 F238L probably damaging Het
Rnf40 A G 7: 127,596,585 K667R possibly damaging Het
Scgb1b12 A T 7: 32,334,495 N60I probably damaging Het
Serpina3n T G 12: 104,409,062 V131G probably benign Het
Slc22a21 T C 11: 53,979,502 Y119C probably damaging Het
Slc22a28 A G 19: 8,117,045 F204S probably damaging Het
Smc6 T A 12: 11,271,820 D29E possibly damaging Het
Sorcs3 G T 19: 48,713,571 L630F probably damaging Het
Sphk1 A G 11: 116,536,156 K306E possibly damaging Het
Spsb1 C T 4: 149,906,844 G89D probably damaging Het
Stat4 G T 1: 52,076,583 M227I probably benign Het
Syngr4 A G 7: 45,887,491 V116A possibly damaging Het
Tacc1 T C 8: 25,240,800 M1V probably null Het
Tcf7l1 T G 6: 72,631,292 K355Q probably damaging Het
Tmem192 T C 8: 64,964,236 S36P probably damaging Het
Top3a G T 11: 60,750,753 N368K possibly damaging Het
Tpk1 T A 6: 43,346,793 I241F possibly damaging Het
Trappc10 A G 10: 78,193,511 I1064T possibly damaging Het
Vmn1r18 T A 6: 57,390,221 K116M probably damaging Het
Vmn2r40 A T 7: 8,920,140 H407Q unknown Het
Vmn2r91 T A 17: 18,107,545 L467H probably damaging Het
Wdr59 G T 8: 111,476,101 S603R probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp324 A C 7: 12,970,600 K74N probably null Het
Zfyve16 A G 13: 92,508,199 L1165P probably damaging Het
Other mutations in Smgc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00797:Smgc APN 15 91854543 splice site probably benign
IGL00835:Smgc APN 15 91844420 missense probably damaging 0.99
IGL01651:Smgc APN 15 91859788 intron probably benign
IGL01669:Smgc APN 15 91860684 missense possibly damaging 0.89
IGL01743:Smgc APN 15 91854593 missense probably benign 0.19
IGL01898:Smgc APN 15 91844524 splice site probably null
IGL03152:Smgc APN 15 91841422 missense possibly damaging 0.66
IGL03172:Smgc APN 15 91860444 missense probably damaging 0.99
IGL03352:Smgc APN 15 91860678 missense probably damaging 0.96
IGL03385:Smgc APN 15 91841978 missense possibly damaging 0.66
K7371:Smgc UTSW 15 91860255 splice site probably benign
R0090:Smgc UTSW 15 91859762 missense possibly damaging 0.91
R0125:Smgc UTSW 15 91854543 splice site probably benign
R0386:Smgc UTSW 15 91854638 missense probably benign 0.07
R0684:Smgc UTSW 15 91841467 unclassified probably benign
R1187:Smgc UTSW 15 91860600 missense probably damaging 0.99
R1586:Smgc UTSW 15 91838393 missense possibly damaging 0.90
R1848:Smgc UTSW 15 91859758 missense possibly damaging 0.58
R1964:Smgc UTSW 15 91860270 missense probably damaging 1.00
R2144:Smgc UTSW 15 91844421 missense possibly damaging 0.81
R3499:Smgc UTSW 15 91842003 missense possibly damaging 0.66
R3842:Smgc UTSW 15 91860262 splice site probably benign
R3978:Smgc UTSW 15 91860348 missense probably damaging 0.99
R4173:Smgc UTSW 15 91860561 missense possibly damaging 0.95
R4692:Smgc UTSW 15 91854561 missense possibly damaging 0.46
R4761:Smgc UTSW 15 91845514 missense possibly damaging 0.66
R4794:Smgc UTSW 15 91841454 missense probably benign 0.27
R4801:Smgc UTSW 15 91854616 missense probably benign 0.01
R4802:Smgc UTSW 15 91854616 missense probably benign 0.01
R5621:Smgc UTSW 15 91844420 missense probably damaging 0.99
R5672:Smgc UTSW 15 91841905 missense possibly damaging 0.46
R5707:Smgc UTSW 15 91860663 missense possibly damaging 0.66
R5722:Smgc UTSW 15 91841906 missense possibly damaging 0.83
R6212:Smgc UTSW 15 91850627 intron probably benign
R7049:Smgc UTSW 15 91860378 missense possibly damaging 0.82
R7155:Smgc UTSW 15 91852608 missense possibly damaging 0.66
R7210:Smgc UTSW 15 91860294 missense probably damaging 0.99
R7448:Smgc UTSW 15 91845493 missense probably benign 0.02
R7474:Smgc UTSW 15 91860694 missense possibly damaging 0.92
R7890:Smgc UTSW 15 91847076 missense possibly damaging 0.46
R8115:Smgc UTSW 15 91849119 critical splice donor site probably null
Z1177:Smgc UTSW 15 91856621 missense unknown
Z1177:Smgc UTSW 15 91856626 missense unknown
Predicted Primers PCR Primer
(F):5'- CAAAAGGCATGCATGTCCTC -3'
(R):5'- CTGGTGATTCATTGCTCATGTC -3'

Sequencing Primer
(F):5'- ATCATTGTTTACCGATCCTCAAGAC -3'
(R):5'- GCTCATGTCATATTTGGGAAAAGATC -3'
Posted On2018-08-29