Mutagenetix > Incidental Mutations

Incidental Mutation 'R6768:Dst'

532020

Institutional Source

Beutler Lab

Gene Symbol

Dst

Ensembl Gene

ENSMUSG00000026131

Gene Name

dystonin

Synonyms

BPAG1-n, ah, athetoid, bullous pemphigoid antigen 1, A830042E19Rik, Macf2, nmf339, Bpag1, nmf203, bullous pemphigoid antigen 1, BPAG1, Bpag, 2310001O04Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.382) question?

Stock #

R6768 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

33908225-34308661 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34181712 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 2199 (E2199G)

Ref Sequence

ENSEMBL: ENSMUSP00000138376 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097785] [ENSMUST00000097786] [ENSMUST00000115104] [ENSMUST00000183034] [ENSMUST00000183302] [ENSMUST00000185269] [ENSMUST00000185897]

Predicted Effect

probably benign
Transcript: ENSMUST00000097785

SMART Domains

Protein: ENSMUSP00000095392
Gene: ENSMUSG00000026131

Domain	Start	End	E-Value	Type
CH	37	136	1.62e-28	SMART
CH	153	250	3.72e-19	SMART
PDB:2ODU\|A	261	479	1e-42	PDB
low complexity region	520	545	N/A	INTRINSIC
SPEC	602	699	8.64e-9	SMART
SPEC	702	802	2.94e-11	SMART
Blast:SPEC	809	973	4e-73	BLAST
coiled coil region	1095	1132	N/A	INTRINSIC
Blast:SPEC	1176	1285	6e-63	BLAST
SPEC	1292	1421	4.11e0	SMART
SPEC	1439	1538	4.66e0	SMART
PLEC	1537	1581	9.05e-3	SMART
PLEC	1582	1619	2.7e0	SMART
PLEC	1657	1694	2.23e0	SMART
PLEC	1695	1732	4.25e1	SMART
PLEC	1735	1770	1.39e2	SMART
PLEC	1771	1808	7.4e-8	SMART
PLEC	1811	1846	5.8e-1	SMART
PLEC	1847	1884	2.71e1	SMART
PLEC	1886	1922	4.66e0	SMART
low complexity region	2294	2307	N/A	INTRINSIC
low complexity region	2366	2381	N/A	INTRINSIC
low complexity region	2477	2491	N/A	INTRINSIC
low complexity region	2566	2593	N/A	INTRINSIC
low complexity region	2661	2675	N/A	INTRINSIC
low complexity region	2793	2799	N/A	INTRINSIC
low complexity region	2839	2847	N/A	INTRINSIC
low complexity region	3046	3057	N/A	INTRINSIC
low complexity region	3294	3314	N/A	INTRINSIC
SPEC	3321	3427	5.36e-1	SMART
low complexity region	3515	3527	N/A	INTRINSIC
low complexity region	3548	3558	N/A	INTRINSIC
SPEC	3569	3678	2.19e-1	SMART
internal_repeat_7	3771	3811	5.09e-5	PROSPERO
SPEC	3852	3971	1.75e-9	SMART
SPEC	3978	4084	3.7e-8	SMART
SPEC	4091	4190	4.56e-8	SMART
SPEC	4200	4299	3.78e0	SMART
low complexity region	4372	4388	N/A	INTRINSIC
SPEC	4447	4552	1.98e-8	SMART
SPEC	4559	4663	3.62e-11	SMART
SPEC	4673	4773	1.65e-5	SMART
SPEC	4780	4882	7.75e-11	SMART
SPEC	4889	4989	2.3e-4	SMART
SPEC	4999	5098	3.01e0	SMART
SPEC	5105	5208	2.74e-2	SMART
SPEC	5215	5319	2.46e-4	SMART
SPEC	5326	5428	1.27e-15	SMART
SPEC	5435	5537	1.54e-14	SMART
SPEC	5544	5646	8.07e-2	SMART
SPEC	5653	5755	3.67e-12	SMART
SPEC	5762	5863	1.97e-12	SMART
SPEC	5870	5976	4.19e-7	SMART
SPEC	5983	6085	2.06e-15	SMART
SPEC	6092	6195	2.89e-10	SMART
SPEC	6202	6304	2.61e-26	SMART
SPEC	6311	6413	5.31e-18	SMART
SPEC	6420	6522	1.25e-14	SMART
SPEC	6529	6632	9.1e-17	SMART
SPEC	6639	6740	9.3e-23	SMART
SPEC	6747	6849	5.43e-15	SMART
SPEC	6859	6989	1.5e-8	SMART
EFh	7023	7051	4.12e-3	SMART
EFh	7059	7087	1.25e-2	SMART
GAS2	7098	7176	3.08e-51	SMART
low complexity region	7224	7242	N/A	INTRINSIC
low complexity region	7252	7264	N/A	INTRINSIC
low complexity region	7313	7336	N/A	INTRINSIC
PDB:3GJO\|H	7364	7393	9e-10	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000097786

SMART Domains

Protein: ENSMUSP00000095393
Gene: ENSMUSG00000026131

Domain	Start	End	E-Value	Type
CH	37	136	1.62e-28	SMART
CH	153	250	3.72e-19	SMART
PDB:2ODU\|A	261	479	6e-43	PDB
low complexity region	520	545	N/A	INTRINSIC
SPEC	602	699	8.64e-9	SMART
SPEC	702	802	2.94e-11	SMART
Blast:SPEC	809	973	2e-73	BLAST
coiled coil region	1095	1132	N/A	INTRINSIC
Blast:SPEC	1176	1285	2e-62	BLAST
SPEC	1292	1421	4.11e0	SMART
SPEC	1439	1538	4.66e0	SMART
SPEC	1555	1664	2.19e-1	SMART
internal_repeat_6	1757	1797	1.18e-5	PROSPERO
SPEC	1838	1957	1.75e-9	SMART
SPEC	1964	2070	3.7e-8	SMART
SPEC	2077	2176	4.56e-8	SMART
SPEC	2186	2285	3.78e0	SMART
low complexity region	2358	2374	N/A	INTRINSIC
SPEC	2433	2538	1.98e-8	SMART
SPEC	2545	2649	3.62e-11	SMART
SPEC	2659	2759	1.65e-5	SMART
SPEC	2766	2868	7.75e-11	SMART
SPEC	2875	2975	2.3e-4	SMART
SPEC	2985	3084	3.01e0	SMART
SPEC	3091	3194	2.74e-2	SMART
SPEC	3201	3305	2.46e-4	SMART
SPEC	3312	3414	1.27e-15	SMART
SPEC	3421	3523	1.54e-14	SMART
SPEC	3530	3632	8.07e-2	SMART
SPEC	3639	3741	3.67e-12	SMART
SPEC	3748	3849	1.97e-12	SMART
SPEC	3856	3962	4.19e-7	SMART
SPEC	3969	4071	2.06e-15	SMART
SPEC	4078	4181	2.89e-10	SMART
SPEC	4188	4290	2.61e-26	SMART
SPEC	4297	4399	5.31e-18	SMART
SPEC	4406	4508	1.25e-14	SMART
SPEC	4515	4618	9.1e-17	SMART
SPEC	4625	4726	9.3e-23	SMART
SPEC	4733	4835	5.43e-15	SMART
SPEC	4845	4975	1.5e-8	SMART
EFh	5009	5037	4.12e-3	SMART
EFh	5045	5073	1.25e-2	SMART
GAS2	5084	5162	3.08e-51	SMART
low complexity region	5210	5228	N/A	INTRINSIC
low complexity region	5238	5250	N/A	INTRINSIC
low complexity region	5299	5322	N/A	INTRINSIC
PDB:3GJO\|H	5350	5379	1e-9	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000115104

SMART Domains

Protein: ENSMUSP00000110756
Gene: ENSMUSG00000026131

Domain	Start	End	E-Value	Type
CH	37	136	1.62e-28	SMART
CH	153	250	3.72e-19	SMART
PDB:2ODU\|A	261	479	1e-42	PDB
low complexity region	520	545	N/A	INTRINSIC
SPEC	602	699	8.64e-9	SMART
SPEC	702	802	2.94e-11	SMART
Blast:SPEC	809	973	4e-73	BLAST
coiled coil region	1095	1132	N/A	INTRINSIC
Blast:SPEC	1176	1285	6e-63	BLAST
SPEC	1292	1421	4.11e0	SMART
SPEC	1439	1538	4.66e0	SMART
PLEC	1537	1581	9.05e-3	SMART
PLEC	1582	1619	2.7e0	SMART
PLEC	1657	1694	2.23e0	SMART
PLEC	1695	1732	4.25e1	SMART
PLEC	1735	1770	1.39e2	SMART
PLEC	1771	1808	7.4e-8	SMART
PLEC	1811	1846	5.8e-1	SMART
PLEC	1847	1884	2.71e1	SMART
PLEC	1886	1922	4.66e0	SMART
low complexity region	2294	2307	N/A	INTRINSIC
low complexity region	2366	2381	N/A	INTRINSIC
low complexity region	2477	2491	N/A	INTRINSIC
low complexity region	2566	2593	N/A	INTRINSIC
low complexity region	2661	2675	N/A	INTRINSIC
low complexity region	2793	2799	N/A	INTRINSIC
low complexity region	2839	2847	N/A	INTRINSIC
low complexity region	3046	3057	N/A	INTRINSIC
low complexity region	3294	3314	N/A	INTRINSIC
SPEC	3321	3427	5.36e-1	SMART
low complexity region	3515	3527	N/A	INTRINSIC
low complexity region	3548	3558	N/A	INTRINSIC
SPEC	3569	3678	2.19e-1	SMART
internal_repeat_7	3771	3811	5.08e-5	PROSPERO
SPEC	3852	3971	1.75e-9	SMART
SPEC	3978	4084	3.7e-8	SMART
SPEC	4091	4190	4.56e-8	SMART
SPEC	4200	4299	3.78e0	SMART
low complexity region	4372	4388	N/A	INTRINSIC
SPEC	4447	4552	1.98e-8	SMART
SPEC	4559	4663	3.62e-11	SMART
SPEC	4673	4773	1.65e-5	SMART
SPEC	4780	4882	7.75e-11	SMART
SPEC	4889	4989	2.3e-4	SMART
SPEC	4999	5098	3.01e0	SMART
SPEC	5105	5208	2.74e-2	SMART
SPEC	5215	5319	2.46e-4	SMART
SPEC	5326	5428	1.27e-15	SMART
SPEC	5435	5537	1.54e-14	SMART
SPEC	5544	5646	8.07e-2	SMART
SPEC	5653	5755	3.67e-12	SMART
SPEC	5762	5863	1.97e-12	SMART
SPEC	5870	5976	4.19e-7	SMART
SPEC	5983	6085	2.06e-15	SMART
SPEC	6092	6195	2.89e-10	SMART
SPEC	6202	6304	2.61e-26	SMART
SPEC	6311	6413	5.31e-18	SMART
SPEC	6420	6522	1.25e-14	SMART
SPEC	6529	6632	9.1e-17	SMART
SPEC	6639	6740	9.3e-23	SMART
SPEC	6747	6849	5.43e-15	SMART
SPEC	6859	6989	1.5e-8	SMART
EFh	7023	7051	4.12e-3	SMART
EFh	7059	7087	1.25e-2	SMART
GAS2	7098	7176	3.85e-52	SMART
low complexity region	7200	7218	N/A	INTRINSIC
low complexity region	7228	7240	N/A	INTRINSIC
low complexity region	7326	7349	N/A	INTRINSIC
PDB:3GJO\|H	7377	7406	9e-10	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000183034

SMART Domains

Protein: ENSMUSP00000138308
Gene: ENSMUSG00000026131

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	82	92	N/A	INTRINSIC
low complexity region	149	163	N/A	INTRINSIC
CH	215	314	1.62e-28	SMART
CH	331	428	3.72e-19	SMART
PDB:2ODU\|A	439	657	1e-42	PDB
low complexity region	698	723	N/A	INTRINSIC
SPEC	780	877	8.64e-9	SMART
SPEC	880	980	2.94e-11	SMART
Blast:SPEC	987	1151	5e-73	BLAST
coiled coil region	1273	1310	N/A	INTRINSIC
Blast:SPEC	1354	1463	8e-63	BLAST
SPEC	1470	1599	4.11e0	SMART
SPEC	1617	1716	4.66e0	SMART
PLEC	1715	1759	9.05e-3	SMART
PLEC	1760	1797	2.7e0	SMART
PLEC	1835	1872	2.23e0	SMART
PLEC	1873	1910	4.25e1	SMART
PLEC	1913	1948	1.39e2	SMART
PLEC	1949	1986	7.4e-8	SMART
PLEC	1989	2024	5.8e-1	SMART
PLEC	2025	2062	2.71e1	SMART
PLEC	2064	2100	4.66e0	SMART
low complexity region	2472	2485	N/A	INTRINSIC
low complexity region	2544	2559	N/A	INTRINSIC
low complexity region	2655	2669	N/A	INTRINSIC
low complexity region	2744	2771	N/A	INTRINSIC
low complexity region	2839	2853	N/A	INTRINSIC
low complexity region	2971	2977	N/A	INTRINSIC
low complexity region	3017	3025	N/A	INTRINSIC
low complexity region	3224	3235	N/A	INTRINSIC
low complexity region	3472	3492	N/A	INTRINSIC
SPEC	3499	3605	5.36e-1	SMART
low complexity region	3693	3705	N/A	INTRINSIC
low complexity region	3726	3736	N/A	INTRINSIC
SPEC	3747	3856	2.19e-1	SMART
internal_repeat_12	3949	3989	5.99e-5	PROSPERO
SPEC	4030	4149	1.75e-9	SMART
SPEC	4156	4262	3.7e-8	SMART
SPEC	4269	4368	4.56e-8	SMART
SPEC	4378	4477	3.78e0	SMART
low complexity region	4550	4566	N/A	INTRINSIC
SPEC	4625	4730	1.98e-8	SMART
SPEC	4737	4841	3.62e-11	SMART
SPEC	4851	4951	1.65e-5	SMART
SPEC	4958	5060	7.75e-11	SMART
SPEC	5067	5167	2.3e-4	SMART
SPEC	5177	5276	3.01e0	SMART
SPEC	5283	5386	2.74e-2	SMART
SPEC	5393	5497	2.46e-4	SMART
SPEC	5504	5606	1.27e-15	SMART
SPEC	5613	5715	1.69e-11	SMART
SPEC	5722	5824	9.33e-5	SMART
SPEC	5831	5933	8.07e-2	SMART
SPEC	5940	6042	3.67e-12	SMART
SPEC	6049	6150	1.97e-12	SMART
SPEC	6157	6263	4.19e-7	SMART
SPEC	6270	6372	2.06e-15	SMART
SPEC	6379	6482	2.89e-10	SMART
SPEC	6489	6591	2.61e-26	SMART
SPEC	6598	6700	5.31e-18	SMART
SPEC	6707	6809	1.25e-14	SMART
SPEC	6816	6919	9.1e-17	SMART
SPEC	6926	7027	9.3e-23	SMART
SPEC	7034	7136	5.43e-15	SMART
SPEC	7146	7276	1.5e-8	SMART
EFh	7310	7338	4.12e-3	SMART
EFh	7346	7374	1.25e-2	SMART
GAS2	7385	7463	3.08e-51	SMART
low complexity region	7511	7529	N/A	INTRINSIC
low complexity region	7539	7551	N/A	INTRINSIC
low complexity region	7637	7660	N/A	INTRINSIC
PDB:3GJO\|H	7688	7717	9e-10	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000183302
AA Change: E2199G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000138376
Gene: ENSMUSG00000026131
AA Change: E2199G

Domain	Start	End	E-Value	Type
PDB:2ODU\|A	2	95	4e-7	PDB
low complexity region	136	161	N/A	INTRINSIC
SPEC	218	315	5.4e-11	SMART
SPEC	318	418	1.8e-13	SMART
Blast:SPEC	425	589	1e-73	BLAST
coiled coil region	711	748	N/A	INTRINSIC
Blast:SPEC	792	901	4e-63	BLAST
SPEC	908	1037	2.6e-2	SMART
coiled coil region	1071	1805	N/A	INTRINSIC
PLEC	2061	2098	1.6e-6	SMART
PLEC	2099	2136	4.4e-10	SMART
PLEC	2137	2172	7.8e-5	SMART
PLEC	2173	2210	6.8e-8	SMART
PLEC	2252	2297	2.7e-3	SMART
PLEC	2298	2348	3.7e-1	SMART
PLEC	2368	2407	5.5e-6	SMART
PLEC	2408	2445	1.5e-14	SMART
PLEC	2446	2483	1.1e-10	SMART
PLEC	2484	2521	1.3e-7	SMART
PLEC	2522	2559	5e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185269

SMART Domains

Protein: ENSMUSP00000141127
Gene: ENSMUSG00000026131

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
PDB:2ODU\|A	56	153	6e-8	PDB
low complexity region	194	219	N/A	INTRINSIC
SPEC	276	373	5.4e-11	SMART
SPEC	376	476	1.8e-13	SMART
Blast:SPEC	483	647	1e-73	BLAST
coiled coil region	769	806	N/A	INTRINSIC
Blast:SPEC	850	959	1e-62	BLAST
SPEC	966	1095	2.6e-2	SMART
SPEC	1113	1212	2.9e-2	SMART
SPEC	1229	1338	1.4e-3	SMART
internal_repeat_10	1431	1471	9.93e-6	PROSPERO
SPEC	1512	1631	1.1e-11	SMART
SPEC	1638	1744	2.3e-10	SMART
SPEC	1751	1850	2.9e-10	SMART
SPEC	1860	1959	2.4e-2	SMART
low complexity region	2032	2048	N/A	INTRINSIC
SPEC	2107	2212	1.2e-10	SMART
SPEC	2219	2323	2.3e-13	SMART
SPEC	2333	2433	1.1e-7	SMART
SPEC	2440	2542	5e-13	SMART
SPEC	2549	2649	1.4e-6	SMART
SPEC	2659	2758	1.9e-2	SMART
SPEC	2765	2868	1.8e-4	SMART
SPEC	2875	2979	1.5e-6	SMART
SPEC	2986	3088	8.2e-18	SMART
SPEC	3095	3197	1.1e-13	SMART
SPEC	3204	3306	6e-7	SMART
SPEC	3313	3415	5.1e-4	SMART
SPEC	3422	3524	2.3e-14	SMART
SPEC	3531	3632	1.3e-14	SMART
SPEC	3639	3745	2.6e-9	SMART
SPEC	3752	3854	1.3e-17	SMART
SPEC	3861	3964	1.8e-12	SMART
SPEC	3971	4073	1.6e-28	SMART
SPEC	4080	4182	3.3e-20	SMART
SPEC	4189	4291	7.6e-17	SMART
SPEC	4298	4401	5.6e-19	SMART
SPEC	4408	4509	5.9e-25	SMART
SPEC	4516	4618	3.4e-17	SMART
SPEC	4628	4758	9.7e-11	SMART
EFh	4792	4820	2e-5	SMART
EFh	4828	4856	6e-5	SMART
GAS2	4867	4945	9.8e-56	SMART
low complexity region	4969	4987	N/A	INTRINSIC
low complexity region	4997	5009	N/A	INTRINSIC
low complexity region	5095	5118	N/A	INTRINSIC
PDB:3GJO\|H	5146	5175	3e-9	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000185897

SMART Domains

Protein: ENSMUSP00000139888
Gene: ENSMUSG00000026131

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
PDB:2ODU\|A	56	161	6e-8	PDB
low complexity region	194	219	N/A	INTRINSIC
SPEC	276	373	5.4e-11	SMART
SPEC	376	476	1.8e-13	SMART
Blast:SPEC	483	648	3e-75	BLAST
coiled coil region	770	807	N/A	INTRINSIC
Blast:SPEC	849	960	2e-58	BLAST
SPEC	967	1096	2.6e-2	SMART
SPEC	1114	1213	2.9e-2	SMART
PLEC	1212	1256	5.5e-5	SMART
PLEC	1257	1294	1.7e-2	SMART
PLEC	1332	1369	1.4e-2	SMART
PLEC	1370	1407	2.7e-1	SMART
PLEC	1410	1445	8.7e-1	SMART
PLEC	1446	1483	4.8e-10	SMART
PLEC	1486	1521	3.6e-3	SMART
PLEC	1522	1559	1.7e-1	SMART
PLEC	1561	1597	3e-2	SMART
low complexity region	1969	1982	N/A	INTRINSIC
low complexity region	2041	2056	N/A	INTRINSIC
low complexity region	2152	2166	N/A	INTRINSIC
low complexity region	2241	2268	N/A	INTRINSIC
low complexity region	2336	2350	N/A	INTRINSIC
low complexity region	2468	2474	N/A	INTRINSIC
low complexity region	2514	2522	N/A	INTRINSIC
low complexity region	2721	2732	N/A	INTRINSIC
low complexity region	2969	2987	N/A	INTRINSIC

Meta Mutation Damage Score

0.1483

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.9%
20x: 97.2%

Validation Efficiency

96% (45/47)

MGI Phenotype

PHENOTYPE: Mutations in this gene produce peripheral nervous system demyelination resulting in impaired muscle function and shorter lifespan. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110051M20Rik	A	T	2: 91,421,958	H19Q	probably damaging	Het
Adam6b	G	A	12: 113,490,243	V227I	probably benign	Het
Agtrap	A	G	4: 148,081,610	V106A	probably benign	Het
Aldh3a2	A	C	11: 61,253,710	S341A	probably benign	Het
Bmper	T	A	9: 23,381,453	C353S	probably damaging	Het
Casq1	C	T	1: 172,219,678	D5N	probably benign	Het
Ccin	G	A	4: 43,984,574	R327H	probably benign	Het
Chuk	A	G	19: 44,096,951	V252A	probably damaging	Het
Colec11	T	C	12: 28,595,101		probably null	Het
Cpeb3	G	A	19: 37,025,032	T643I	possibly damaging	Het
Ctcfl	A	G	2: 173,117,291	V214A	possibly damaging	Het
Eno2	T	C	6: 124,767,748	E45G	probably damaging	Het
Foxa2	T	C	2: 148,043,827	H181R	probably damaging	Het
Fpgs	A	G	2: 32,686,623	S331P	probably benign	Het
Gm47189	A	G	14: 41,770,078	S81P	probably benign	Het
Igsf8	C	A	1: 172,317,532	P142Q	probably damaging	Het
Islr	G	T	9: 58,157,610	Q205K	possibly damaging	Het
Josd1	A	G	15: 79,677,122	W162R	probably benign	Het
Lrrc37a	G	A	11: 103,500,123	T1492I	probably benign	Het
Meox1	A	G	11: 101,879,335	F189L	probably damaging	Het
Mtf1	G	A	4: 124,837,785	D385N	probably benign	Het
Naip2	A	T	13: 100,178,324	C315*	probably null	Het
Ncaph2	T	A	15: 89,363,999	Y166*	probably null	Het
Nr1i3	G	A	1: 171,217,397	V270M	probably damaging	Het
Olfr155	T	C	4: 43,854,351	I14T	probably benign	Het
Olfr747	A	G	14: 50,681,592	L14S	probably damaging	Het
Panx3	T	C	9: 37,664,026	K180R	probably benign	Het
Pi4ka	A	G	16: 17,376,982	L184P	possibly damaging	Het
Reln	A	C	5: 21,978,907	V1698G	probably damaging	Het
Rnf213	G	T	11: 119,442,236	R2757L	probably damaging	Het
Scgb2b26	G	T	7: 33,944,954	T4K	probably damaging	Het
Sdhb	A	G	4: 140,979,053	E267G	probably damaging	Het
Sorbs1	A	T	19: 40,327,547	N383K	probably damaging	Het
Stk11ip	T	A	1: 75,532,635	C766S	probably benign	Het
Taf6l	A	C	19: 8,774,549	S592A	probably damaging	Het
Tmem145	G	A	7: 25,308,636	G235D	probably damaging	Het
Tuba3b	T	A	6: 145,618,729		probably null	Het
Ubl7	A	T	9: 57,912,762	E32D	probably benign	Het
Vmn1r168	A	T	7: 23,541,035	T106S	probably damaging	Het
Vmn2r59	C	A	7: 42,011,968	V808F	probably benign	Het
Vmn2r61	C	T	7: 42,300,324	P723S	probably damaging	Het
Wwc2	A	G	8: 47,900,791	Y103H	possibly damaging	Het
Zfp11	G	T	5: 129,658,351	D15E	probably benign	Het
Zfp428	G	A	7: 24,515,483	G162R	probably damaging	Het
Zfp629	G	A	7: 127,610,825	T604I	probably benign	Het
Zfpm1	C	A	8: 122,334,456	D253E	probably damaging	Het
Zhx1	G	T	15: 58,054,103	T249K	probably benign	Het

Other mutations in Dst

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00233:Dst	APN	1	34251839	missense	probably damaging	1.00
IGL00309:Dst	APN	1	34160652	missense	probably damaging	1.00
IGL00334:Dst	APN	1	34166292	missense	probably damaging	1.00
IGL00470:Dst	APN	1	34188962	missense	probably damaging	1.00
IGL00481:Dst	APN	1	34169329	splice site	probably benign
IGL00499:Dst	APN	1	34290423	missense	probably damaging	0.99
IGL00803:Dst	APN	1	34164124	missense	possibly damaging	0.89
IGL00850:Dst	APN	1	34306624	missense	probably damaging	1.00
IGL00957:Dst	APN	1	34228407	missense	probably benign	0.27
IGL00975:Dst	APN	1	34188312	missense	possibly damaging	0.86
IGL00984:Dst	APN	1	34256320	missense	probably damaging	1.00
IGL01284:Dst	APN	1	34163928	missense	probably damaging	1.00
IGL01393:Dst	APN	1	34167625	missense	possibly damaging	0.91
IGL01397:Dst	APN	1	34257744	missense	probably damaging	1.00
IGL01399:Dst	APN	1	34117517	missense	probably benign	0.41
IGL01412:Dst	APN	1	34242620	missense	probably benign	0.21
IGL01527:Dst	APN	1	34247653	missense	probably damaging	1.00
IGL01537:Dst	APN	1	34275320	missense	probably damaging	1.00
IGL01618:Dst	APN	1	34188909	nonsense	probably null
IGL01636:Dst	APN	1	34215569	missense	probably damaging	1.00
IGL01642:Dst	APN	1	34189389	missense	probably damaging	1.00
IGL01672:Dst	APN	1	34225693	missense	probably damaging	1.00
IGL01685:Dst	APN	1	34170452	missense	probably damaging	0.99
IGL01694:Dst	APN	1	34188160	missense	probably benign	0.13
IGL01777:Dst	APN	1	34199397	missense	probably benign	0.07
IGL01800:Dst	APN	1	34262092	missense	probably damaging	1.00
IGL01811:Dst	APN	1	34164092	missense	probably damaging	1.00
IGL01960:Dst	APN	1	34290489	missense	probably damaging	1.00
IGL02031:Dst	APN	1	34189917	missense	possibly damaging	0.95
IGL02103:Dst	APN	1	34190118	missense	possibly damaging	0.90
IGL02121:Dst	APN	1	34228657	missense	probably damaging	1.00
IGL02315:Dst	APN	1	34198665	missense	probably damaging	1.00
IGL02317:Dst	APN	1	34295163	missense	probably damaging	1.00
IGL02469:Dst	APN	1	34188828	missense	probably damaging	1.00
IGL02492:Dst	APN	1	34152193	splice site	probably benign
IGL02510:Dst	APN	1	34229251	splice site	probably null
IGL02522:Dst	APN	1	34250700	splice site	probably benign
IGL02540:Dst	APN	1	34135204	missense	probably damaging	1.00
IGL02588:Dst	APN	1	34117484	missense	probably damaging	1.00
IGL02676:Dst	APN	1	34307587	missense	probably damaging	1.00
IGL02688:Dst	APN	1	34195952	missense	probably damaging	1.00
IGL02700:Dst	APN	1	34262120	missense	probably damaging	1.00
IGL02794:Dst	APN	1	34270829	missense	probably damaging	1.00
IGL02823:Dst	APN	1	34192083	missense	possibly damaging	0.83
IGL02935:Dst	APN	1	34186845	nonsense	probably null
IGL02940:Dst	APN	1	34289587	missense	probably benign	0.36
IGL02994:Dst	APN	1	34229252	splice site	probably benign
IGL02996:Dst	APN	1	34188398	missense	possibly damaging	0.93
IGL02998:Dst	APN	1	34268275	missense	probably damaging	1.00
IGL03027:Dst	APN	1	34186025	missense	possibly damaging	0.51
IGL03033:Dst	APN	1	34169745	splice site	probably benign
IGL03099:Dst	APN	1	34275781	missense	probably damaging	1.00
IGL03119:Dst	APN	1	34161062	missense	probably damaging	1.00
IGL03121:Dst	APN	1	34217803	splice site	probably benign
IGL03132:Dst	APN	1	34256641	missense	probably benign	0.06
IGL03220:Dst	APN	1	34185995	missense	probably damaging	0.99
IGL03230:Dst	APN	1	34184052	nonsense	probably null
IGL03245:Dst	APN	1	34211148	splice site	probably null
IGL03380:Dst	APN	1	34257800	missense	probably damaging	1.00
Doodle	UTSW	1	34208558	nonsense	probably null
gobble	UTSW	1	34165155	critical splice donor site	probably null
Phelps	UTSW	1	34223795	splice site	probably null
tinsel	UTSW	1	34164167	missense	probably damaging	1.00
Wastable	UTSW	1	34295289	missense	probably damaging	1.00
E0370:Dst	UTSW	1	34249471	splice site	probably benign
FR4304:Dst	UTSW	1	34200964	missense	probably damaging	0.99
IGL02799:Dst	UTSW	1	34179849	missense	possibly damaging	0.92
R0006:Dst	UTSW	1	34228918	missense	probably benign	0.30
R0006:Dst	UTSW	1	34228918	missense	probably benign	0.30
R0023:Dst	UTSW	1	34189119	missense	probably damaging	1.00
R0023:Dst	UTSW	1	34189119	missense	probably damaging	1.00
R0024:Dst	UTSW	1	34189119	missense	probably damaging	1.00
R0027:Dst	UTSW	1	34189119	missense	probably damaging	1.00
R0049:Dst	UTSW	1	34275781	missense	probably damaging	1.00
R0053:Dst	UTSW	1	34294550	splice site	probably null
R0053:Dst	UTSW	1	34294550	splice site	probably null
R0058:Dst	UTSW	1	34006224	missense	possibly damaging	0.93
R0066:Dst	UTSW	1	34189553	missense	possibly damaging	0.67
R0066:Dst	UTSW	1	34189553	missense	possibly damaging	0.67
R0085:Dst	UTSW	1	34229187	missense	probably damaging	1.00
R0125:Dst	UTSW	1	34270903	missense	probably damaging	1.00
R0152:Dst	UTSW	1	34189119	missense	probably damaging	1.00
R0165:Dst	UTSW	1	34154646	splice site	probably benign
R0172:Dst	UTSW	1	34270854	missense	probably damaging	1.00
R0207:Dst	UTSW	1	34186935	missense	probably benign	0.02
R0219:Dst	UTSW	1	34303478	missense	probably damaging	0.99
R0349:Dst	UTSW	1	34199553	missense	probably benign	0.12
R0386:Dst	UTSW	1	34217836	missense	probably damaging	1.00
R0389:Dst	UTSW	1	34294550	splice site	probably null
R0395:Dst	UTSW	1	34189119	missense	probably damaging	1.00
R0423:Dst	UTSW	1	34278035	missense	possibly damaging	0.95
R0443:Dst	UTSW	1	34294550	splice site	probably null
R0472:Dst	UTSW	1	34266960	critical splice donor site	probably null
R0490:Dst	UTSW	1	34307368	nonsense	probably null
R0513:Dst	UTSW	1	34219531	splice site	probably benign
R0539:Dst	UTSW	1	34189119	missense	probably damaging	1.00
R0562:Dst	UTSW	1	34227981	missense	probably damaging	1.00
R0569:Dst	UTSW	1	34293427	missense	probably damaging	1.00
R0600:Dst	UTSW	1	34189119	missense	probably damaging	1.00
R0608:Dst	UTSW	1	34290356	splice site	probably null
R0609:Dst	UTSW	1	34266960	critical splice donor site	probably null
R0630:Dst	UTSW	1	34193450	missense	probably benign	0.05
R0630:Dst	UTSW	1	34199473	missense	probably damaging	0.98
R0632:Dst	UTSW	1	34271413	missense	probably damaging	1.00
R0713:Dst	UTSW	1	34189119	missense	probably damaging	1.00
R0724:Dst	UTSW	1	34188677	missense	probably benign	0.00
R0761:Dst	UTSW	1	34182767	missense	probably benign	0.33
R0801:Dst	UTSW	1	34170389	missense	probably damaging	0.99
R0829:Dst	UTSW	1	34163220	missense	probably damaging	1.00
R0939:Dst	UTSW	1	34244383	missense	probably damaging	1.00
R0945:Dst	UTSW	1	34271419	missense	probably damaging	1.00
R0992:Dst	UTSW	1	34199536	missense	probably damaging	0.97
R1018:Dst	UTSW	1	34194093	missense	probably damaging	1.00
R1077:Dst	UTSW	1	34164167	missense	probably damaging	1.00
R1079:Dst	UTSW	1	34186863	missense	possibly damaging	0.86
R1127:Dst	UTSW	1	34275277	missense	probably damaging	1.00
R1129:Dst	UTSW	1	34199554	missense	probably benign	0.28
R1141:Dst	UTSW	1	34188696	missense	possibly damaging	0.85
R1167:Dst	UTSW	1	34223858	missense	probably damaging	1.00
R1195:Dst	UTSW	1	34211154	missense	probably damaging	1.00
R1195:Dst	UTSW	1	34211154	missense	probably damaging	1.00
R1195:Dst	UTSW	1	34211154	missense	probably damaging	1.00
R1333:Dst	UTSW	1	34228347	missense	probably damaging	1.00
R1352:Dst	UTSW	1	34229248	critical splice donor site	probably null
R1365:Dst	UTSW	1	34188194	missense	probably benign	0.02
R1382:Dst	UTSW	1	34268833	missense	probably damaging	0.99
R1389:Dst	UTSW	1	34211232	missense	probably damaging	1.00
R1394:Dst	UTSW	1	34165155	critical splice donor site	probably null
R1395:Dst	UTSW	1	34165155	critical splice donor site	probably null
R1435:Dst	UTSW	1	34113945	missense	probably damaging	1.00
R1450:Dst	UTSW	1	34188395	missense	probably damaging	1.00
R1450:Dst	UTSW	1	34212259	missense	probably damaging	0.99
R1453:Dst	UTSW	1	34189446	missense	possibly damaging	0.85
R1479:Dst	UTSW	1	34264515	splice site	probably null
R1483:Dst	UTSW	1	34252998	missense	probably damaging	1.00
R1491:Dst	UTSW	1	34154594	missense	probably damaging	0.99
R1536:Dst	UTSW	1	34260372	splice site	probably benign
R1551:Dst	UTSW	1	34192212	missense	probably benign	0.01
R1573:Dst	UTSW	1	34201231	missense	probably damaging	1.00
R1614:Dst	UTSW	1	34275263	missense	probably damaging	1.00
R1615:Dst	UTSW	1	34199371	missense	probably damaging	1.00
R1645:Dst	UTSW	1	34225722	missense	probably damaging	1.00
R1655:Dst	UTSW	1	34282576	nonsense	probably null
R1663:Dst	UTSW	1	34163385	missense	probably damaging	1.00
R1674:Dst	UTSW	1	34223795	splice site	probably null
R1702:Dst	UTSW	1	34167340	missense	probably damaging	1.00
R1707:Dst	UTSW	1	34167646	missense	probably damaging	1.00
R1747:Dst	UTSW	1	34160709	missense	probably damaging	1.00
R1760:Dst	UTSW	1	34228603	missense	probably damaging	1.00
R1773:Dst	UTSW	1	34291899	missense	probably damaging	0.99
R1793:Dst	UTSW	1	34152471	nonsense	probably null
R1842:Dst	UTSW	1	34164119	missense	probably null	0.98
R1869:Dst	UTSW	1	34252832	missense	probably damaging	0.99
R1879:Dst	UTSW	1	34188843	missense	probably benign	0.15
R1883:Dst	UTSW	1	34189308	missense	possibly damaging	0.74
R1912:Dst	UTSW	1	34291850	missense	probably damaging	1.00
R1920:Dst	UTSW	1	34161029	missense	probably damaging	0.99
R1921:Dst	UTSW	1	34161029	missense	probably damaging	0.99
R1943:Dst	UTSW	1	34228369	missense	possibly damaging	0.67
R1958:Dst	UTSW	1	34163721	missense	probably damaging	1.00
R1962:Dst	UTSW	1	34191016	missense	possibly damaging	0.47
R1991:Dst	UTSW	1	34190258	missense	probably benign	0.11
R1998:Dst	UTSW	1	34256347	missense	probably damaging	1.00
R2001:Dst	UTSW	1	34184063	missense	probably damaging	0.97
R2007:Dst	UTSW	1	34226012	splice site	probably benign
R2021:Dst	UTSW	1	34166291	missense	possibly damaging	0.70
R2022:Dst	UTSW	1	34166291	missense	possibly damaging	0.70
R2035:Dst	UTSW	1	34271413	missense	probably damaging	1.00
R2077:Dst	UTSW	1	34211170	missense	probably damaging	1.00
R2103:Dst	UTSW	1	34190258	missense	probably benign	0.11
R2111:Dst	UTSW	1	34169178	missense	probably damaging	1.00
R2112:Dst	UTSW	1	34169178	missense	probably damaging	1.00
R2113:Dst	UTSW	1	34275236	missense	probably damaging	0.97
R2201:Dst	UTSW	1	34195921	missense	possibly damaging	0.60
R2214:Dst	UTSW	1	34271401	missense	probably damaging	1.00
R2219:Dst	UTSW	1	34170433	missense	probably damaging	1.00
R2233:Dst	UTSW	1	34274262	missense	probably damaging	1.00
R2267:Dst	UTSW	1	34295466	missense	probably damaging	1.00
R2290:Dst	UTSW	1	34229200	missense	probably damaging	1.00
R2323:Dst	UTSW	1	34228437	missense	possibly damaging	0.93
R2424:Dst	UTSW	1	34167060	missense	probably damaging	1.00
R2426:Dst	UTSW	1	34192812	missense	probably benign	0.03
R2495:Dst	UTSW	1	34199373	missense	probably damaging	0.99
R2507:Dst	UTSW	1	34011909	missense	probably damaging	0.98
R2507:Dst	UTSW	1	34188417	missense	possibly damaging	0.85
R2510:Dst	UTSW	1	34212286	missense	probably benign
R2831:Dst	UTSW	1	34275292	missense	probably damaging	1.00
R2929:Dst	UTSW	1	34167062	nonsense	probably null
R3033:Dst	UTSW	1	34152285	missense	probably damaging	0.99
R3121:Dst	UTSW	1	34289648	missense	probably damaging	1.00
R3424:Dst	UTSW	1	34198505	splice site	probably benign
R3437:Dst	UTSW	1	34190222	missense	probably damaging	1.00
R3699:Dst	UTSW	1	34213074	splice site	probably benign
R3739:Dst	UTSW	1	34268894	splice site	probably benign
R3796:Dst	UTSW	1	34181915	missense	probably benign	0.15
R3847:Dst	UTSW	1	34212319	missense	probably damaging	1.00
R3848:Dst	UTSW	1	34212319	missense	probably damaging	1.00
R3849:Dst	UTSW	1	34212319	missense	probably damaging	1.00
R3850:Dst	UTSW	1	34189274	nonsense	probably null
R3850:Dst	UTSW	1	34212319	missense	probably damaging	1.00
R3873:Dst	UTSW	1	34289620	missense	probably damaging	1.00
R3875:Dst	UTSW	1	34171247	missense	probably damaging	1.00
R3973:Dst	UTSW	1	34011898	missense	probably benign	0.34
R4014:Dst	UTSW	1	34191282	nonsense	probably null
R4043:Dst	UTSW	1	34190684	missense	probably benign	0.03
R4057:Dst	UTSW	1	34186054	splice site	probably benign
R4074:Dst	UTSW	1	34192269	missense	probably benign	0.20
R4074:Dst	UTSW	1	34228461	missense	probably damaging	0.97
R4075:Dst	UTSW	1	34192269	missense	probably benign	0.20
R4076:Dst	UTSW	1	34192269	missense	probably benign	0.20
R4206:Dst	UTSW	1	34212247	missense	probably damaging	1.00
R4230:Dst	UTSW	1	34195828	missense	probably benign	0.04
R4242:Dst	UTSW	1	34006216	missense	possibly damaging	0.88
R4273:Dst	UTSW	1	34192340	missense	possibly damaging	0.72
R4366:Dst	UTSW	1	34251878	missense	probably damaging	1.00
R4370:Dst	UTSW	1	34251728	frame shift	probably null
R4379:Dst	UTSW	1	34163235	missense	probably damaging	1.00
R4379:Dst	UTSW	1	34227975	missense	probably benign	0.07
R4380:Dst	UTSW	1	34163235	missense	probably damaging	1.00
R4381:Dst	UTSW	1	34163235	missense	probably damaging	1.00
R4423:Dst	UTSW	1	34188393	missense	possibly damaging	0.76
R4427:Dst	UTSW	1	34181460	missense	probably benign	0.19
R4456:Dst	UTSW	1	34190719	missense	probably benign	0.06
R4469:Dst	UTSW	1	34191842	missense	probably benign	0.02
R4502:Dst	UTSW	1	34247691	missense	probably damaging	0.99
R4503:Dst	UTSW	1	34262253	critical splice donor site	probably null
R4545:Dst	UTSW	1	34188738	missense	probably damaging	0.99
R4610:Dst	UTSW	1	34169856	missense	probably damaging	1.00
R4633:Dst	UTSW	1	34170434	missense	probably damaging	1.00
R4675:Dst	UTSW	1	34275703	missense	possibly damaging	0.94
R4687:Dst	UTSW	1	34201123	missense	probably damaging	1.00
R4739:Dst	UTSW	1	34191147	missense	probably benign	0.01
R4751:Dst	UTSW	1	34191884	missense	probably benign	0.21
R4754:Dst	UTSW	1	34212309	missense	probably damaging	1.00
R4771:Dst	UTSW	1	34249484	missense	probably damaging	1.00
R4819:Dst	UTSW	1	33968835	missense	probably benign	0.03
R4830:Dst	UTSW	1	34198505	splice site	probably null
R4839:Dst	UTSW	1	34190862	missense	probably damaging	0.96
R4845:Dst	UTSW	1	34193127	missense	probably benign	0.02
R4904:Dst	UTSW	1	34169798	missense	probably damaging	0.99
R4932:Dst	UTSW	1	34228683	missense	possibly damaging	0.47
R4934:Dst	UTSW	1	34208588	missense	probably damaging	1.00
R4952:Dst	UTSW	1	34271422	missense	probably damaging	1.00
R4961:Dst	UTSW	1	33968823	missense	possibly damaging	0.53
R4976:Dst	UTSW	1	34195969	nonsense	probably null
R4980:Dst	UTSW	1	34256288	missense	probably damaging	1.00
R5011:Dst	UTSW	1	34250647	missense	probably damaging	1.00
R5013:Dst	UTSW	1	34250647	missense	probably damaging	1.00
R5059:Dst	UTSW	1	34163346	missense	possibly damaging	0.70
R5074:Dst	UTSW	1	34295263	missense	probably damaging	1.00
R5114:Dst	UTSW	1	34202559	missense	probably damaging	0.98
R5119:Dst	UTSW	1	34195969	nonsense	probably null
R5182:Dst	UTSW	1	34179086	missense	probably benign
R5236:Dst	UTSW	1	34164417	missense	probably damaging	1.00
R5240:Dst	UTSW	1	34208558	nonsense	probably null
R5254:Dst	UTSW	1	34177931	nonsense	probably null
R5275:Dst	UTSW	1	34180148	missense	probably benign	0.13
R5281:Dst	UTSW	1	34257782	missense	probably benign	0.29
R5299:Dst	UTSW	1	34135092	missense	probably damaging	1.00
R5316:Dst	UTSW	1	34223848	missense	probably damaging	0.97
R5319:Dst	UTSW	1	34225977	missense	possibly damaging	0.95
R5425:Dst	UTSW	1	34179750	missense	probably benign	0.00
R5443:Dst	UTSW	1	34228539	missense	probably damaging	1.00
R5522:Dst	UTSW	1	34257873	missense	possibly damaging	0.46
R5537:Dst	UTSW	1	34189878	missense	probably benign	0.25
R5548:Dst	UTSW	1	34189328	missense	probably benign
R5557:Dst	UTSW	1	34282586	missense	probably damaging	1.00
R5597:Dst	UTSW	1	34192713	missense	probably benign	0.07
R5623:Dst	UTSW	1	34190133	missense	possibly damaging	0.56
R5630:Dst	UTSW	1	34188785	frame shift	probably null
R5660:Dst	UTSW	1	34282493	missense	probably damaging	1.00
R5730:Dst	UTSW	1	34117526	unclassified	probably null
R5762:Dst	UTSW	1	34179357	missense	probably damaging	0.99
R5810:Dst	UTSW	1	34183040	intron	probably benign
R5816:Dst	UTSW	1	34179234	missense	probably benign
R5846:Dst	UTSW	1	34195861	nonsense	probably null
R5874:Dst	UTSW	1	34179589	missense	probably damaging	0.98
R5899:Dst	UTSW	1	34295289	missense	probably damaging	1.00
R5923:Dst	UTSW	1	34181759	missense	probably benign	0.00
R5936:Dst	UTSW	1	34307458	missense	probably damaging	1.00
R5946:Dst	UTSW	1	34174192	missense	probably benign	0.01
R5950:Dst	UTSW	1	34262060	missense	probably damaging	1.00
R5958:Dst	UTSW	1	34186050	missense	probably damaging	0.97
R5973:Dst	UTSW	1	34156857	missense	probably damaging	1.00
R5979:Dst	UTSW	1	34160372	intron	probably benign
R5980:Dst	UTSW	1	34182891	missense	probably benign	0.34
R5984:Dst	UTSW	1	34172263	missense	probably benign	0.05
R6000:Dst	UTSW	1	34212223	missense	possibly damaging	0.92
R6014:Dst	UTSW	1	34264834	missense	probably damaging	1.00
R6042:Dst	UTSW	1	34188972	missense	probably damaging	1.00
R6064:Dst	UTSW	1	34194051	missense	probably damaging	1.00
R6126:Dst	UTSW	1	34228183	missense	probably damaging	1.00
R6157:Dst	UTSW	1	34211172	missense	probably damaging	1.00
R6162:Dst	UTSW	1	34006237	missense	probably damaging	0.99
R6185:Dst	UTSW	1	34173080	missense	probably damaging	0.99
R6226:Dst	UTSW	1	34270874	missense	probably damaging	1.00
R6227:Dst	UTSW	1	34194540	missense	probably benign	0.41
R6232:Dst	UTSW	1	34188172	missense	probably damaging	1.00
R6259:Dst	UTSW	1	34182396	missense	probably benign	0.26
R6267:Dst	UTSW	1	34228672	missense	probably damaging	1.00
R6273:Dst	UTSW	1	34275266	missense	probably damaging	1.00
R6284:Dst	UTSW	1	34229085	missense	probably damaging	1.00
R6347:Dst	UTSW	1	34179684	unclassified	probably null
R6365:Dst	UTSW	1	34191927	missense	probably damaging	1.00
R6385:Dst	UTSW	1	34307468	missense	possibly damaging	0.85
R6389:Dst	UTSW	1	34193184	missense	probably damaging	0.99
R6395:Dst	UTSW	1	34182690	missense	probably benign	0.17
R6416:Dst	UTSW	1	34116128	missense	probably damaging	1.00
R6467:Dst	UTSW	1	34295196	missense	probably damaging	1.00
R6470:Dst	UTSW	1	34295237	missense	probably damaging	1.00
R6477:Dst	UTSW	1	34208728	intron	probably null
R6485:Dst	UTSW	1	34294529	missense	probably damaging	1.00
R6491:Dst	UTSW	1	34193012	missense	probably benign	0.10
R6525:Dst	UTSW	1	34163135	missense	probably damaging	1.00
R6533:Dst	UTSW	1	34303509	missense	probably benign	0.08
R6595:Dst	UTSW	1	34250680	missense	probably damaging	1.00
R6622:Dst	UTSW	1	34179251	missense	probably benign	0.22
R6646:Dst	UTSW	1	34268807	missense	possibly damaging	0.80
R6648:Dst	UTSW	1	34262041	missense	possibly damaging	0.84
R6700:Dst	UTSW	1	34256323	missense	probably damaging	1.00
R6743:Dst	UTSW	1	34270890	missense	probably damaging	1.00
R6761:Dst	UTSW	1	34214550	missense	probably damaging	1.00
R6766:Dst	UTSW	1	34294483	missense	probably damaging	1.00
R6810:Dst	UTSW	1	34212298	missense	probably damaging	1.00
R6815:Dst	UTSW	1	34228369	missense	possibly damaging	0.67
R6820:Dst	UTSW	1	34211256	missense	probably damaging	1.00
R6822:Dst	UTSW	1	34275674	missense	probably damaging	0.99
R6831:Dst	UTSW	1	34190684	missense	probably benign	0.03
R6874:Dst	UTSW	1	34289651	missense	probably benign	0.29
R6945:Dst	UTSW	1	34190490	missense	probably damaging	1.00
R6985:Dst	UTSW	1	34190853	missense	probably benign	0.08
R6995:Dst	UTSW	1	34166234	missense	probably damaging	1.00
R7038:Dst	UTSW	1	34182798	nonsense	probably null
R7043:Dst	UTSW	1	34257911	missense	probably damaging	0.99
R7070:Dst	UTSW	1	34275302	missense	probably damaging	1.00
R7097:Dst	UTSW	1	34169260	missense	probably damaging	1.00
R7139:Dst	UTSW	1	34299807	missense	probably damaging	0.97
R7144:Dst	UTSW	1	34152243	missense	probably damaging	1.00
R7145:Dst	UTSW	1	34189882	missense	probably benign
R7158:Dst	UTSW	1	34274285	missense	probably benign
R7207:Dst	UTSW	1	34163337	missense	probably damaging	0.98
R7320:Dst	UTSW	1	34191094	missense	probably benign
R7324:Dst	UTSW	1	34006224	missense	possibly damaging	0.93
R7327:Dst	UTSW	1	34201405	missense	probably damaging	1.00
R7340:Dst	UTSW	1	34190729	missense	probably benign	0.01
R7358:Dst	UTSW	1	34191673	missense	probably benign
R7373:Dst	UTSW	1	34188391	missense	probably benign	0.02
R7376:Dst	UTSW	1	34192689	missense	probably benign
R7453:Dst	UTSW	1	34191358	missense	possibly damaging	0.95
R7467:Dst	UTSW	1	34191155	missense	probably benign	0.00
R7471:Dst	UTSW	1	34194570	missense	possibly damaging	0.49
R7472:Dst	UTSW	1	34218497	missense	probably benign	0.02
R7485:Dst	UTSW	1	34274189	missense	probably benign	0.31
R7504:Dst	UTSW	1	34201017	missense	probably damaging	1.00
R7516:Dst	UTSW	1	34170479	missense	probably benign	0.10
R7524:Dst	UTSW	1	34291893	missense	possibly damaging	0.94
R7528:Dst	UTSW	1	34294522	missense	probably damaging	1.00
R7560:Dst	UTSW	1	34182451	missense	possibly damaging	0.92
R7582:Dst	UTSW	1	34169883	missense	probably damaging	1.00
R7585:Dst	UTSW	1	34114015	missense	possibly damaging	0.50
R7594:Dst	UTSW	1	34213013	missense	probably damaging	1.00
R7600:Dst	UTSW	1	34266930	missense	probably damaging	1.00
R7619:Dst	UTSW	1	34199428	missense	probably benign	0.02
R7623:Dst	UTSW	1	34170436	missense	probably damaging	0.99
R7649:Dst	UTSW	1	34167697	missense	probably benign	0.13
R7654:Dst	UTSW	1	34228977	missense	probably damaging	1.00
R7654:Dst	UTSW	1	34228978	missense	probably damaging	1.00
R7661:Dst	UTSW	1	34256353	critical splice donor site	probably null
R7667:Dst	UTSW	1	34179035	missense	possibly damaging	0.82
R7677:Dst	UTSW	1	34169322	critical splice donor site	probably null
R7698:Dst	UTSW	1	34190387	missense	probably benign	0.02
R7765:Dst	UTSW	1	34275694	missense	probably damaging	0.97
R7772:Dst	UTSW	1	34181388	missense	possibly damaging	0.90
R7779:Dst	UTSW	1	34194597	missense	probably damaging	0.99
R7791:Dst	UTSW	1	34154592	missense	probably damaging	0.99
R7821:Dst	UTSW	1	34275362	critical splice donor site	probably null
RF014:Dst	UTSW	1	34247679	missense	probably benign	0.00
X0026:Dst	UTSW	1	34213055	missense	probably damaging	0.97
X0028:Dst	UTSW	1	34192199	missense	probably damaging	1.00
X0063:Dst	UTSW	1	34195895	missense	probably damaging	1.00
X0066:Dst	UTSW	1	34275703	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCTACCTCCATTGCAGGAC -3'
(R):5'- AGCCATTTCTGGAGGGACAC -3'

Sequencing Primer
(F):5'- AAAAATGTCGTTCACTTCGGCGG -3'
(R):5'- TTTCTGGAGGGACACGGACG -3'

Posted On

2018-08-29