Incidental Mutation 'R6768:Stk11ip'
ID532021
Institutional Source Beutler Lab
Gene Symbol Stk11ip
Ensembl Gene ENSMUSG00000026213
Gene Nameserine/threonine kinase 11 interacting protein
Synonyms1200014D22Rik, LKB1IP, LIP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6768 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location75521529-75537335 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75532635 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 766 (C766S)
Ref Sequence ENSEMBL: ENSMUSP00000109182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027414] [ENSMUST00000113553]
Predicted Effect probably benign
Transcript: ENSMUST00000027414
AA Change: C766S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027414
Gene: ENSMUSG00000026213
AA Change: C766S

DomainStartEndE-ValueType
low complexity region 25 41 N/A INTRINSIC
SCOP:d1h6ua2 74 291 2e-19 SMART
Blast:LRR 208 231 2e-6 BLAST
Blast:LRR 253 276 5e-6 BLAST
Blast:LRR 278 304 2e-8 BLAST
low complexity region 376 386 N/A INTRINSIC
coiled coil region 495 528 N/A INTRINSIC
low complexity region 752 767 N/A INTRINSIC
low complexity region 948 959 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113553
AA Change: C766S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109182
Gene: ENSMUSG00000026213
AA Change: C766S

DomainStartEndE-ValueType
Pfam:LIP1 4 94 2.9e-45 PFAM
low complexity region 175 194 N/A INTRINSIC
Blast:LRR 208 231 2e-6 BLAST
Blast:LRR 253 276 5e-6 BLAST
Blast:LRR 278 304 2e-8 BLAST
low complexity region 376 386 N/A INTRINSIC
coiled coil region 495 528 N/A INTRINSIC
low complexity region 752 767 N/A INTRINSIC
low complexity region 948 959 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.2%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,421,958 H19Q probably damaging Het
Adam6b G A 12: 113,490,243 V227I probably benign Het
Agtrap A G 4: 148,081,610 V106A probably benign Het
Aldh3a2 A C 11: 61,253,710 S341A probably benign Het
Bmper T A 9: 23,381,453 C353S probably damaging Het
Casq1 C T 1: 172,219,678 D5N probably benign Het
Ccin G A 4: 43,984,574 R327H probably benign Het
Chuk A G 19: 44,096,951 V252A probably damaging Het
Colec11 T C 12: 28,595,101 probably null Het
Cpeb3 G A 19: 37,025,032 T643I possibly damaging Het
Ctcfl A G 2: 173,117,291 V214A possibly damaging Het
Dst A G 1: 34,181,712 E2199G probably damaging Het
Eno2 T C 6: 124,767,748 E45G probably damaging Het
Foxa2 T C 2: 148,043,827 H181R probably damaging Het
Fpgs A G 2: 32,686,623 S331P probably benign Het
Gm47189 A G 14: 41,770,078 S81P probably benign Het
Igsf8 C A 1: 172,317,532 P142Q probably damaging Het
Islr G T 9: 58,157,610 Q205K possibly damaging Het
Josd1 A G 15: 79,677,122 W162R probably benign Het
Lrrc37a G A 11: 103,500,123 T1492I probably benign Het
Meox1 A G 11: 101,879,335 F189L probably damaging Het
Mtf1 G A 4: 124,837,785 D385N probably benign Het
Naip2 A T 13: 100,178,324 C315* probably null Het
Ncaph2 T A 15: 89,363,999 Y166* probably null Het
Nr1i3 G A 1: 171,217,397 V270M probably damaging Het
Olfr155 T C 4: 43,854,351 I14T probably benign Het
Olfr747 A G 14: 50,681,592 L14S probably damaging Het
Panx3 T C 9: 37,664,026 K180R probably benign Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Reln A C 5: 21,978,907 V1698G probably damaging Het
Rnf213 G T 11: 119,442,236 R2757L probably damaging Het
Scgb2b26 G T 7: 33,944,954 T4K probably damaging Het
Sdhb A G 4: 140,979,053 E267G probably damaging Het
Sorbs1 A T 19: 40,327,547 N383K probably damaging Het
Taf6l A C 19: 8,774,549 S592A probably damaging Het
Tmem145 G A 7: 25,308,636 G235D probably damaging Het
Tuba3b T A 6: 145,618,729 probably null Het
Ubl7 A T 9: 57,912,762 E32D probably benign Het
Vmn1r168 A T 7: 23,541,035 T106S probably damaging Het
Vmn2r59 C A 7: 42,011,968 V808F probably benign Het
Vmn2r61 C T 7: 42,300,324 P723S probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp11 G T 5: 129,658,351 D15E probably benign Het
Zfp428 G A 7: 24,515,483 G162R probably damaging Het
Zfp629 G A 7: 127,610,825 T604I probably benign Het
Zfpm1 C A 8: 122,334,456 D253E probably damaging Het
Zhx1 G T 15: 58,054,103 T249K probably benign Het
Other mutations in Stk11ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Stk11ip APN 1 75530266 missense probably damaging 1.00
IGL01776:Stk11ip APN 1 75527821 missense probably benign 0.02
IGL02752:Stk11ip APN 1 75524681 critical splice acceptor site probably null
IGL03132:Stk11ip APN 1 75536089 missense probably benign 0.00
IGL03188:Stk11ip APN 1 75534435 missense probably benign 0.00
R6768_Stk11ip_021 UTSW 1 75532635 missense probably benign
sienna UTSW 1 75527355 splice site probably null
R0234:Stk11ip UTSW 1 75529067 missense possibly damaging 0.47
R0234:Stk11ip UTSW 1 75529067 missense possibly damaging 0.47
R0617:Stk11ip UTSW 1 75532288 splice site probably null
R0712:Stk11ip UTSW 1 75527447 missense probably damaging 0.99
R1672:Stk11ip UTSW 1 75528985 nonsense probably null
R1694:Stk11ip UTSW 1 75527386 missense probably damaging 1.00
R1891:Stk11ip UTSW 1 75532416 missense probably benign 0.08
R2061:Stk11ip UTSW 1 75529584 missense possibly damaging 0.94
R2094:Stk11ip UTSW 1 75525521 splice site probably benign
R2851:Stk11ip UTSW 1 75529267 splice site probably benign
R2852:Stk11ip UTSW 1 75529267 splice site probably benign
R4765:Stk11ip UTSW 1 75527155 missense probably damaging 1.00
R4775:Stk11ip UTSW 1 75533853 missense possibly damaging 0.95
R4785:Stk11ip UTSW 1 75530281 missense possibly damaging 0.95
R5002:Stk11ip UTSW 1 75532543 intron probably benign
R5524:Stk11ip UTSW 1 75532327 missense probably damaging 1.00
R5538:Stk11ip UTSW 1 75528335 missense probably damaging 1.00
R5849:Stk11ip UTSW 1 75527355 splice site probably null
R5927:Stk11ip UTSW 1 75524691 missense possibly damaging 0.93
R6053:Stk11ip UTSW 1 75534255 critical splice donor site probably null
R6485:Stk11ip UTSW 1 75529968 missense possibly damaging 0.47
R6734:Stk11ip UTSW 1 75532369 missense probably benign 0.04
R7070:Stk11ip UTSW 1 75527615 missense probably benign 0.39
R7882:Stk11ip UTSW 1 75529464 missense probably benign 0.03
X0066:Stk11ip UTSW 1 75534426 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATTCTGCCTGTGACCTCG -3'
(R):5'- GCAACTATCCACAGCTGCAG -3'

Sequencing Primer
(F):5'- TGATGGCATCCCACCTCAG -3'
(R):5'- GCTGCAGCTGAAACCCAAG -3'
Posted On2018-08-29