Incidental Mutation 'R6768:Casq1'
ID 532023
Institutional Source Beutler Lab
Gene Symbol Casq1
Ensembl Gene ENSMUSG00000007122
Gene Name calsequestrin 1
Synonyms CSQ-1, CSQ1, CSQ, sCSQ
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6768 (G1)
Quality Score 221.009
Status Validated
Chromosome 1
Chromosomal Location 172209894-172219868 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 172219678 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 5 (D5N)
Ref Sequence ENSEMBL: ENSMUSP00000003554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003554] [ENSMUST00000111243] [ENSMUST00000170700]
AlphaFold O09165
Predicted Effect probably benign
Transcript: ENSMUST00000003554
AA Change: D5N

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000003554
Gene: ENSMUSG00000007122
AA Change: D5N

DomainStartEndE-ValueType
Pfam:Calsequestrin 11 402 5.3e-238 PFAM
Pfam:Thioredoxin_6 186 379 2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111243
SMART Domains Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
Cation_ATPase_N 51 125 1.22e-14 SMART
Pfam:E1-E2_ATPase 144 375 2.6e-59 PFAM
Pfam:Hydrolase 380 738 8.1e-19 PFAM
Pfam:HAD 383 735 1.6e-17 PFAM
Pfam:Cation_ATPase 437 531 9.2e-25 PFAM
Pfam:Cation_ATPase_C 808 1017 1.2e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170700
AA Change: D5N

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000129647
Gene: ENSMUSG00000007122
AA Change: D5N

DomainStartEndE-ValueType
Pfam:Calsequestrin 11 94 9.7e-38 PFAM
Pfam:Calsequestrin 89 156 6.9e-38 PFAM
Meta Mutation Damage Score 0.0865 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.2%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the skeletal muscle specific member of the calsequestrin protein family. Calsequestrin functions as a luminal sarcoplasmic reticulum calcium sensor in both cardiac and skeletal muscle cells. This protein, also known as calmitine, functions as a calcium regulator in the mitochondria of skeletal muscle. This protein is absent in patients with Duchenne and Becker types of muscular dystrophy. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for an insertional mutation that inactivates the gene exhibit structural alterations of the Ca2+ release units, an increased frequency of mitochondria, and significantly impaired calcium handling in skeletal muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,421,958 H19Q probably damaging Het
Adam6b G A 12: 113,490,243 V227I probably benign Het
Agtrap A G 4: 148,081,610 V106A probably benign Het
Aldh3a2 A C 11: 61,253,710 S341A probably benign Het
Bmper T A 9: 23,381,453 C353S probably damaging Het
Ccin G A 4: 43,984,574 R327H probably benign Het
Chuk A G 19: 44,096,951 V252A probably damaging Het
Colec11 T C 12: 28,595,101 probably null Het
Cpeb3 G A 19: 37,025,032 T643I possibly damaging Het
Ctcfl A G 2: 173,117,291 V214A possibly damaging Het
Dst A G 1: 34,181,712 E2199G probably damaging Het
Eno2 T C 6: 124,767,748 E45G probably damaging Het
Foxa2 T C 2: 148,043,827 H181R probably damaging Het
Fpgs A G 2: 32,686,623 S331P probably benign Het
Gm47189 A G 14: 41,770,078 S81P probably benign Het
Igsf8 C A 1: 172,317,532 P142Q probably damaging Het
Islr G T 9: 58,157,610 Q205K possibly damaging Het
Josd1 A G 15: 79,677,122 W162R probably benign Het
Lrrc37a G A 11: 103,500,123 T1492I probably benign Het
Meox1 A G 11: 101,879,335 F189L probably damaging Het
Mtf1 G A 4: 124,837,785 D385N probably benign Het
Naip2 A T 13: 100,178,324 C315* probably null Het
Ncaph2 T A 15: 89,363,999 Y166* probably null Het
Nr1i3 G A 1: 171,217,397 V270M probably damaging Het
Olfr155 T C 4: 43,854,351 I14T probably benign Het
Olfr747 A G 14: 50,681,592 L14S probably damaging Het
Panx3 T C 9: 37,664,026 K180R probably benign Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Reln A C 5: 21,978,907 V1698G probably damaging Het
Rnf213 G T 11: 119,442,236 R2757L probably damaging Het
Scgb2b26 G T 7: 33,944,954 T4K probably damaging Het
Sdhb A G 4: 140,979,053 E267G probably damaging Het
Sorbs1 A T 19: 40,327,547 N383K probably damaging Het
Stk11ip T A 1: 75,532,635 C766S probably benign Het
Taf6l A C 19: 8,774,549 S592A probably damaging Het
Tmem145 G A 7: 25,308,636 G235D probably damaging Het
Tuba3b T A 6: 145,618,729 probably null Het
Ubl7 A T 9: 57,912,762 E32D probably benign Het
Vmn1r168 A T 7: 23,541,035 T106S probably damaging Het
Vmn2r59 C A 7: 42,011,968 V808F probably benign Het
Vmn2r61 C T 7: 42,300,324 P723S probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp11 G T 5: 129,658,351 D15E probably benign Het
Zfp428 G A 7: 24,515,483 G162R probably damaging Het
Zfp629 G A 7: 127,610,825 T604I probably benign Het
Zfpm1 C A 8: 122,334,456 D253E probably damaging Het
Zhx1 G T 15: 58,054,103 T249K probably benign Het
Other mutations in Casq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02165:Casq1 APN 1 172213381 missense probably damaging 0.96
IGL02699:Casq1 APN 1 172219696 start gained probably benign
IGL02756:Casq1 APN 1 172215105 missense probably damaging 1.00
PIT4377001:Casq1 UTSW 1 172212001 missense probably benign 0.15
R0026:Casq1 UTSW 1 172219400 splice site probably benign
R0026:Casq1 UTSW 1 172219400 splice site probably benign
R0124:Casq1 UTSW 1 172210425 missense probably damaging 1.00
R0485:Casq1 UTSW 1 172210390 unclassified probably benign
R1982:Casq1 UTSW 1 172215530 missense probably damaging 1.00
R2095:Casq1 UTSW 1 172215962 missense probably benign 0.26
R2097:Casq1 UTSW 1 172210421 missense probably damaging 1.00
R3940:Casq1 UTSW 1 172219536 missense possibly damaging 0.91
R4654:Casq1 UTSW 1 172210398 unclassified probably benign
R4790:Casq1 UTSW 1 172216837 missense probably damaging 1.00
R5002:Casq1 UTSW 1 172213378 missense possibly damaging 0.50
R5187:Casq1 UTSW 1 172213074 missense possibly damaging 0.54
R5307:Casq1 UTSW 1 172219416 missense probably damaging 1.00
R5973:Casq1 UTSW 1 172219501 missense probably damaging 1.00
R6251:Casq1 UTSW 1 172216840 missense probably benign 0.17
R7380:Casq1 UTSW 1 172216849 missense probably benign 0.07
R9014:Casq1 UTSW 1 172210497 missense probably damaging 1.00
R9292:Casq1 UTSW 1 172215547 missense probably damaging 1.00
Z1176:Casq1 UTSW 1 172215914 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATTGTCTCTGCGAGGCCTTG -3'
(R):5'- TCTGTCGGCAGTTTCTCCAG -3'

Sequencing Primer
(F):5'- GAGGGCCAGCACCTCATACTTC -3'
(R):5'- AGTTTCTCCAGGACCCAGCAG -3'
Posted On 2018-08-29