Incidental Mutation 'R6768:Sdhb'
ID532032
Institutional Source Beutler Lab
Gene Symbol Sdhb
Ensembl Gene ENSMUSG00000009863
Gene Namesuccinate dehydrogenase complex, subunit B, iron sulfur (Ip)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6768 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location140961203-140979193 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 140979053 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 267 (E267G)
Ref Sequence ENSEMBL: ENSMUSP00000010007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010007]
Predicted Effect probably damaging
Transcript: ENSMUST00000010007
AA Change: E267G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010007
Gene: ENSMUSG00000009863
AA Change: E267G

DomainStartEndE-ValueType
Pfam:Fer2_3 43 150 5e-36 PFAM
Pfam:Fer4_8 185 259 2.2e-9 PFAM
Pfam:Fer4_17 187 260 1.8e-11 PFAM
Pfam:Fer4_18 193 262 1e-9 PFAM
Meta Mutation Damage Score 0.1877 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 97.2%
Validation Efficiency 96% (45/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Complex II of the respiratory chain, which is specifically involved in the oxidation of succinate, carries electrons from FADH to CoQ. The complex is composed of four nuclear-encoded subunits and is localized in the mitochondrial inner membrane. The iron-sulfur subunit is highly conserved and contains three cysteine-rich clusters which may comprise the iron-sulfur centers of the enzyme. Sporadic and familial mutations in this gene result in paragangliomas and pheochromocytoma, and support a link between mitochondrial dysfunction and tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: The gene is involved in the hypoxia-induced RNA editing pathway in monocytes. Heterozygous compound KOs show reduced increase in blood hemoglobin under hypoxic conditions. Homozygous inactivation of this gene results in complete embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A T 2: 91,421,958 H19Q probably damaging Het
Adam6b G A 12: 113,490,243 V227I probably benign Het
Agtrap A G 4: 148,081,610 V106A probably benign Het
Aldh3a2 A C 11: 61,253,710 S341A probably benign Het
Bmper T A 9: 23,381,453 C353S probably damaging Het
Casq1 C T 1: 172,219,678 D5N probably benign Het
Ccin G A 4: 43,984,574 R327H probably benign Het
Chuk A G 19: 44,096,951 V252A probably damaging Het
Colec11 T C 12: 28,595,101 probably null Het
Cpeb3 G A 19: 37,025,032 T643I possibly damaging Het
Ctcfl A G 2: 173,117,291 V214A possibly damaging Het
Dst A G 1: 34,181,712 E2199G probably damaging Het
Eno2 T C 6: 124,767,748 E45G probably damaging Het
Foxa2 T C 2: 148,043,827 H181R probably damaging Het
Fpgs A G 2: 32,686,623 S331P probably benign Het
Gm47189 A G 14: 41,770,078 S81P probably benign Het
Igsf8 C A 1: 172,317,532 P142Q probably damaging Het
Islr G T 9: 58,157,610 Q205K possibly damaging Het
Josd1 A G 15: 79,677,122 W162R probably benign Het
Lrrc37a G A 11: 103,500,123 T1492I probably benign Het
Meox1 A G 11: 101,879,335 F189L probably damaging Het
Mtf1 G A 4: 124,837,785 D385N probably benign Het
Naip2 A T 13: 100,178,324 C315* probably null Het
Ncaph2 T A 15: 89,363,999 Y166* probably null Het
Nr1i3 G A 1: 171,217,397 V270M probably damaging Het
Olfr155 T C 4: 43,854,351 I14T probably benign Het
Olfr747 A G 14: 50,681,592 L14S probably damaging Het
Panx3 T C 9: 37,664,026 K180R probably benign Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Reln A C 5: 21,978,907 V1698G probably damaging Het
Rnf213 G T 11: 119,442,236 R2757L probably damaging Het
Scgb2b26 G T 7: 33,944,954 T4K probably damaging Het
Sorbs1 A T 19: 40,327,547 N383K probably damaging Het
Stk11ip T A 1: 75,532,635 C766S probably benign Het
Taf6l A C 19: 8,774,549 S592A probably damaging Het
Tmem145 G A 7: 25,308,636 G235D probably damaging Het
Tuba3b T A 6: 145,618,729 probably null Het
Ubl7 A T 9: 57,912,762 E32D probably benign Het
Vmn1r168 A T 7: 23,541,035 T106S probably damaging Het
Vmn2r59 C A 7: 42,011,968 V808F probably benign Het
Vmn2r61 C T 7: 42,300,324 P723S probably damaging Het
Wwc2 A G 8: 47,900,791 Y103H possibly damaging Het
Zfp11 G T 5: 129,658,351 D15E probably benign Het
Zfp428 G A 7: 24,515,483 G162R probably damaging Het
Zfp629 G A 7: 127,610,825 T604I probably benign Het
Zfpm1 C A 8: 122,334,456 D253E probably damaging Het
Zhx1 G T 15: 58,054,103 T249K probably benign Het
Other mutations in Sdhb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Sdhb APN 4 140977480 missense probably damaging 1.00
IGL01542:Sdhb APN 4 140972967 missense probably benign
IGL01790:Sdhb APN 4 140973727 missense probably benign
IGL03003:Sdhb APN 4 140973000 missense probably damaging 1.00
R1070:Sdhb UTSW 4 140971236 splice site probably benign
R1971:Sdhb UTSW 4 140972949 missense possibly damaging 0.81
R2008:Sdhb UTSW 4 140979029 missense probably damaging 1.00
R2358:Sdhb UTSW 4 140973000 missense probably damaging 1.00
R3821:Sdhb UTSW 4 140979088 nonsense probably null
R4202:Sdhb UTSW 4 140979068 missense possibly damaging 0.64
R4611:Sdhb UTSW 4 140972915 missense probably damaging 1.00
R4782:Sdhb UTSW 4 140977466 missense possibly damaging 0.59
R4799:Sdhb UTSW 4 140977466 missense possibly damaging 0.59
R6235:Sdhb UTSW 4 140973673 missense probably damaging 0.98
R6426:Sdhb UTSW 4 140973718 missense probably benign 0.01
R6787:Sdhb UTSW 4 140976190 missense probably damaging 1.00
R7255:Sdhb UTSW 4 140977418 missense possibly damaging 0.55
R7520:Sdhb UTSW 4 140966571 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CGAATCCTGACCTTGGCTTG -3'
(R):5'- CAACCGTCTTTGGTAATAATGGAG -3'

Sequencing Primer
(F):5'- TCCTAGAGGAAGCACCATGC -3'
(R):5'- CTTTGGTAATAATGGAGAGTAACGCC -3'
Posted On2018-08-29