Mutagenetix > Incidental Mutation

Incidental Mutation 'R6768:Reln'

532034

Institutional Source

Beutler Lab

Gene Symbol

Reln

Ensembl Gene

ENSMUSG00000042453

Gene Name

reelin

Synonyms

MMRRC Submission

044884-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.951) question?

Stock #

R6768 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21884454-22344702 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 21978907 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 1698 (V1698G)

Ref Sequence

ENSEMBL: ENSMUSP00000124052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000062372
AA Change: V1698G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: V1698G

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	40	172	6.1e-24	PFAM
internal_repeat_3	195	360	5.04e-6	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3450	3457	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000161356
AA Change: V1698G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: V1698G

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	54	171	2.9e-10	PFAM
internal_repeat_3	195	360	5.06e-6	PROSPERO
internal_repeat_2	207	413	3.41e-11	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
internal_repeat_2	1452	1660	3.41e-11	PROSPERO
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3452	3459	N/A	INTRINSIC

Meta Mutation Damage Score

0.6540

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.9%
20x: 97.2%

Validation Efficiency

96% (45/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6b	G	A	12: 113,490,243 (GRCm38)	V227I	probably benign	Het
Agtrap	A	G	4: 148,081,610 (GRCm38)	V106A	probably benign	Het
Aldh3a2	A	C	11: 61,253,710 (GRCm38)	S341A	probably benign	Het
Bmper	T	A	9: 23,381,453 (GRCm38)	C353S	probably damaging	Het
Casq1	C	T	1: 172,219,678 (GRCm38)	D5N	probably benign	Het
Ccin	G	A	4: 43,984,574 (GRCm38)	R327H	probably benign	Het
Chuk	A	G	19: 44,096,951 (GRCm38)	V252A	probably damaging	Het
Colec11	T	C	12: 28,595,101 (GRCm38)		probably null	Het
Cpeb3	G	A	19: 37,025,032 (GRCm38)	T643I	possibly damaging	Het
Cstpp1	A	T	2: 91,421,958 (GRCm38)	H19Q	probably damaging	Het
Ctcfl	A	G	2: 173,117,291 (GRCm38)	V214A	possibly damaging	Het
Dst	A	G	1: 34,181,712 (GRCm38)	E2199G	probably damaging	Het
Eno2	T	C	6: 124,767,748 (GRCm38)	E45G	probably damaging	Het
Foxa2	T	C	2: 148,043,827 (GRCm38)	H181R	probably damaging	Het
Fpgs	A	G	2: 32,686,623 (GRCm38)	S331P	probably benign	Het
Gm47189	A	G	14: 41,770,078 (GRCm38)	S81P	probably benign	Het
Igsf8	C	A	1: 172,317,532 (GRCm38)	P142Q	probably damaging	Het
Islr	G	T	9: 58,157,610 (GRCm38)	Q205K	possibly damaging	Het
Josd1	A	G	15: 79,677,122 (GRCm38)	W162R	probably benign	Het
Lrrc37a	G	A	11: 103,500,123 (GRCm38)	T1492I	probably benign	Het
Meox1	A	G	11: 101,879,335 (GRCm38)	F189L	probably damaging	Het
Mtf1	G	A	4: 124,837,785 (GRCm38)	D385N	probably benign	Het
Naip2	A	T	13: 100,178,324 (GRCm38)	C315*	probably null	Het
Ncaph2	T	A	15: 89,363,999 (GRCm38)	Y166*	probably null	Het
Nr1i3	G	A	1: 171,217,397 (GRCm38)	V270M	probably damaging	Het
Or11h4b	A	G	14: 50,681,592 (GRCm38)	L14S	probably damaging	Het
Or13c7	T	C	4: 43,854,351 (GRCm38)	I14T	probably benign	Het
Panx3	T	C	9: 37,664,026 (GRCm38)	K180R	probably benign	Het
Pi4ka	A	G	16: 17,376,982 (GRCm38)	L184P	possibly damaging	Het
Rnf213	G	T	11: 119,442,236 (GRCm38)	R2757L	probably damaging	Het
Scgb2b26	G	T	7: 33,944,954 (GRCm38)	T4K	probably damaging	Het
Sdhb	A	G	4: 140,979,053 (GRCm38)	E267G	probably damaging	Het
Sorbs1	A	T	19: 40,327,547 (GRCm38)	N383K	probably damaging	Het
Stk11ip	T	A	1: 75,532,635 (GRCm38)	C766S	probably benign	Het
Taf6l	A	C	19: 8,774,549 (GRCm38)	S592A	probably damaging	Het
Tmem145	G	A	7: 25,308,636 (GRCm38)	G235D	probably damaging	Het
Tuba3b	T	A	6: 145,618,729 (GRCm38)		probably null	Het
Ubl7	A	T	9: 57,912,762 (GRCm38)	E32D	probably benign	Het
Vmn1r168	A	T	7: 23,541,035 (GRCm38)	T106S	probably damaging	Het
Vmn2r59	C	A	7: 42,011,968 (GRCm38)	V808F	probably benign	Het
Vmn2r61	C	T	7: 42,300,324 (GRCm38)	P723S	probably damaging	Het
Wwc2	A	G	8: 47,900,791 (GRCm38)	Y103H	possibly damaging	Het
Zfp11	G	T	5: 129,658,351 (GRCm38)	D15E	probably benign	Het
Zfp428	G	A	7: 24,515,483 (GRCm38)	G162R	probably damaging	Het
Zfp629	G	A	7: 127,610,825 (GRCm38)	T604I	probably benign	Het
Zfpm1	C	A	8: 122,334,456 (GRCm38)	D253E	probably damaging	Het
Zhx1	G	T	15: 58,054,103 (GRCm38)	T249K	probably benign	Het

Other mutations in Reln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Reln	APN	5	22,039,565 (GRCm38)	missense	possibly damaging	0.57
IGL00091:Reln	APN	5	22,039,565 (GRCm38)	missense	possibly damaging	0.57
IGL00432:Reln	APN	5	22,010,127 (GRCm38)	missense	probably damaging	1.00
IGL00433:Reln	APN	5	22,045,009 (GRCm38)	missense	probably damaging	1.00
IGL00576:Reln	APN	5	22,154,950 (GRCm38)	missense	probably benign	0.01
IGL00755:Reln	APN	5	22,060,380 (GRCm38)	missense	probably damaging	0.98
IGL00777:Reln	APN	5	22,018,850 (GRCm38)	critical splice donor site	probably null
IGL00900:Reln	APN	5	21,980,117 (GRCm38)	missense	probably damaging	0.98
IGL01067:Reln	APN	5	21,979,666 (GRCm38)	missense	probably damaging	1.00
IGL01104:Reln	APN	5	21,986,967 (GRCm38)	missense	probably damaging	0.99
IGL01141:Reln	APN	5	21,969,033 (GRCm38)	missense	probably damaging	1.00
IGL01141:Reln	APN	5	21,919,069 (GRCm38)	missense	probably damaging	1.00
IGL01333:Reln	APN	5	22,171,251 (GRCm38)	missense	probably damaging	0.99
IGL01341:Reln	APN	5	21,969,079 (GRCm38)	missense	probably damaging	1.00
IGL01354:Reln	APN	5	21,919,175 (GRCm38)	nonsense	probably null
IGL01361:Reln	APN	5	21,919,021 (GRCm38)	missense	probably benign	0.06
IGL01446:Reln	APN	5	21,969,317 (GRCm38)	missense	probably damaging	0.99
IGL01448:Reln	APN	5	22,040,405 (GRCm38)	missense	probably benign	0.40
IGL01612:Reln	APN	5	21,896,930 (GRCm38)	missense	probably damaging	0.99
IGL01695:Reln	APN	5	21,920,438 (GRCm38)	missense	probably damaging	1.00
IGL01718:Reln	APN	5	21,947,514 (GRCm38)	missense	possibly damaging	0.60
IGL01749:Reln	APN	5	22,344,246 (GRCm38)	nonsense	probably null
IGL01875:Reln	APN	5	21,904,717 (GRCm38)	missense	probably benign
IGL02013:Reln	APN	5	21,950,879 (GRCm38)	missense	probably damaging	1.00
IGL02031:Reln	APN	5	21,979,016 (GRCm38)	missense	probably damaging	0.99
IGL02186:Reln	APN	5	21,909,958 (GRCm38)	missense	probably damaging	1.00
IGL02228:Reln	APN	5	21,904,731 (GRCm38)	missense	probably damaging	0.99
IGL02248:Reln	APN	5	21,910,992 (GRCm38)	missense	probably damaging	1.00
IGL02336:Reln	APN	5	21,929,134 (GRCm38)	missense	probably damaging	1.00
IGL02352:Reln	APN	5	22,039,565 (GRCm38)	missense	possibly damaging	0.57
IGL02359:Reln	APN	5	22,039,565 (GRCm38)	missense	possibly damaging	0.57
IGL02376:Reln	APN	5	22,080,791 (GRCm38)	nonsense	probably null
IGL02408:Reln	APN	5	21,901,619 (GRCm38)	missense	probably benign	0.44
IGL02415:Reln	APN	5	21,971,951 (GRCm38)	missense	possibly damaging	0.91
IGL02512:Reln	APN	5	22,040,427 (GRCm38)	missense	probably benign	0.00
IGL02540:Reln	APN	5	22,034,752 (GRCm38)	missense	probably damaging	0.96
IGL02624:Reln	APN	5	22,103,357 (GRCm38)	missense	probably benign	0.09
IGL02720:Reln	APN	5	21,997,941 (GRCm38)	missense	probably damaging	0.99
IGL02894:Reln	APN	5	21,885,548 (GRCm38)	missense	possibly damaging	0.72
IGL02999:Reln	APN	5	21,995,365 (GRCm38)	missense	probably damaging	1.00
IGL03125:Reln	APN	5	21,910,844 (GRCm38)	missense	probably damaging	1.00
IGL03298:Reln	APN	5	21,910,836 (GRCm38)	missense	probably damaging	0.99
Fishing	UTSW	5	21,896,841 (GRCm38)	missense	probably damaging	1.00
P0020:Reln	UTSW	5	22,106,060 (GRCm38)	missense	possibly damaging	0.91
PIT4151001:Reln	UTSW	5	22,286,896 (GRCm38)	missense	possibly damaging	0.71
R0018:Reln	UTSW	5	21,925,371 (GRCm38)	missense	probably benign	0.01
R0105:Reln	UTSW	5	22,048,815 (GRCm38)	missense	probably damaging	0.99
R0105:Reln	UTSW	5	22,048,815 (GRCm38)	missense	probably damaging	0.99
R0127:Reln	UTSW	5	22,004,136 (GRCm38)	missense	probably damaging	1.00
R0135:Reln	UTSW	5	22,128,649 (GRCm38)	missense	probably damaging	0.99
R0144:Reln	UTSW	5	21,948,449 (GRCm38)	missense	probably damaging	0.97
R0240:Reln	UTSW	5	22,106,045 (GRCm38)	missense	probably benign	0.36
R0240:Reln	UTSW	5	22,106,045 (GRCm38)	missense	probably benign	0.36
R0242:Reln	UTSW	5	21,942,597 (GRCm38)	critical splice donor site	probably null
R0242:Reln	UTSW	5	21,942,597 (GRCm38)	critical splice donor site	probably null
R0266:Reln	UTSW	5	21,988,776 (GRCm38)	missense	probably damaging	1.00
R0269:Reln	UTSW	5	21,920,537 (GRCm38)	missense	probably damaging	1.00
R0280:Reln	UTSW	5	22,227,513 (GRCm38)	splice site	probably benign
R0333:Reln	UTSW	5	21,929,242 (GRCm38)	missense	probably damaging	0.97
R0357:Reln	UTSW	5	21,950,822 (GRCm38)	missense	probably damaging	1.00
R0359:Reln	UTSW	5	22,048,800 (GRCm38)	missense	probably damaging	0.98
R0506:Reln	UTSW	5	21,920,496 (GRCm38)	missense	probably damaging	0.97
R0534:Reln	UTSW	5	21,947,408 (GRCm38)	missense	probably damaging	0.99
R0535:Reln	UTSW	5	22,051,276 (GRCm38)	splice site	probably benign
R0541:Reln	UTSW	5	21,980,109 (GRCm38)	missense	possibly damaging	0.88
R0615:Reln	UTSW	5	22,010,150 (GRCm38)	missense	probably benign	0.36
R0617:Reln	UTSW	5	21,920,537 (GRCm38)	missense	probably damaging	1.00
R0634:Reln	UTSW	5	22,018,869 (GRCm38)	missense	probably damaging	1.00
R0653:Reln	UTSW	5	21,913,230 (GRCm38)	missense	probably benign	0.44
R0704:Reln	UTSW	5	21,896,811 (GRCm38)	missense	probably damaging	0.99
R0706:Reln	UTSW	5	21,896,811 (GRCm38)	missense	probably damaging	0.99
R0959:Reln	UTSW	5	22,227,628 (GRCm38)	missense	probably damaging	0.96
R1066:Reln	UTSW	5	22,034,664 (GRCm38)	missense	probably damaging	1.00
R1110:Reln	UTSW	5	22,034,775 (GRCm38)	missense	probably benign
R1163:Reln	UTSW	5	21,899,029 (GRCm38)	missense	probably benign	0.03
R1222:Reln	UTSW	5	21,986,955 (GRCm38)	missense	probably null	0.97
R1226:Reln	UTSW	5	21,910,866 (GRCm38)	missense	probably damaging	1.00
R1440:Reln	UTSW	5	22,128,602 (GRCm38)	splice site	probably benign
R1532:Reln	UTSW	5	22,034,744 (GRCm38)	missense	probably damaging	0.99
R1552:Reln	UTSW	5	21,960,378 (GRCm38)	missense	probably benign	0.01
R1565:Reln	UTSW	5	21,925,213 (GRCm38)	missense	probably benign	0.05
R1618:Reln	UTSW	5	22,060,368 (GRCm38)	missense	probably benign	0.01
R1636:Reln	UTSW	5	21,998,683 (GRCm38)	missense	probably damaging	0.99
R1664:Reln	UTSW	5	21,929,086 (GRCm38)	missense	probably damaging	1.00
R1716:Reln	UTSW	5	21,955,095 (GRCm38)	missense	probably damaging	0.98
R1759:Reln	UTSW	5	22,010,289 (GRCm38)	missense	probably damaging	0.99
R1835:Reln	UTSW	5	21,979,002 (GRCm38)	missense	probably damaging	1.00
R1907:Reln	UTSW	5	22,044,962 (GRCm38)	critical splice donor site	probably null
R1991:Reln	UTSW	5	21,969,360 (GRCm38)	missense	possibly damaging	0.56
R2046:Reln	UTSW	5	21,942,627 (GRCm38)	missense	probably benign	0.01
R2072:Reln	UTSW	5	21,919,177 (GRCm38)	missense	probably damaging	1.00
R2103:Reln	UTSW	5	21,969,360 (GRCm38)	missense	possibly damaging	0.56
R2119:Reln	UTSW	5	22,019,000 (GRCm38)	missense	probably damaging	1.00
R2120:Reln	UTSW	5	21,969,085 (GRCm38)	missense	probably damaging	1.00
R2216:Reln	UTSW	5	22,048,005 (GRCm38)	missense	probably benign	0.30
R2219:Reln	UTSW	5	21,972,047 (GRCm38)	missense	possibly damaging	0.88
R2228:Reln	UTSW	5	21,987,078 (GRCm38)	missense	possibly damaging	0.69
R2306:Reln	UTSW	5	21,896,786 (GRCm38)	missense	probably damaging	1.00
R2316:Reln	UTSW	5	22,154,956 (GRCm38)	missense	probably benign	0.00
R2321:Reln	UTSW	5	21,915,020 (GRCm38)	missense	probably damaging	0.99
R2512:Reln	UTSW	5	21,979,690 (GRCm38)	missense	possibly damaging	0.89
R2519:Reln	UTSW	5	22,344,369 (GRCm38)	missense	unknown
R2870:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2870:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22,049,791 (GRCm38)	missense	possibly damaging	0.95
R3195:Reln	UTSW	5	22,040,420 (GRCm38)	missense	possibly damaging	0.72
R3545:Reln	UTSW	5	22,227,600 (GRCm38)	missense	possibly damaging	0.64
R3546:Reln	UTSW	5	22,227,600 (GRCm38)	missense	possibly damaging	0.64
R3547:Reln	UTSW	5	22,227,600 (GRCm38)	missense	possibly damaging	0.64
R3706:Reln	UTSW	5	21,995,589 (GRCm38)	splice site	probably benign
R3713:Reln	UTSW	5	21,904,734 (GRCm38)	missense	probably damaging	0.99
R3770:Reln	UTSW	5	21,948,566 (GRCm38)	missense	probably damaging	1.00
R3836:Reln	UTSW	5	21,911,014 (GRCm38)	missense	probably damaging	1.00
R3887:Reln	UTSW	5	21,910,849 (GRCm38)	missense	possibly damaging	0.92
R3972:Reln	UTSW	5	21,979,001 (GRCm38)	missense	probably damaging	0.99
R3975:Reln	UTSW	5	21,995,366 (GRCm38)	missense	possibly damaging	0.57
R4022:Reln	UTSW	5	22,227,630 (GRCm38)	missense	probably benign	0.45
R4044:Reln	UTSW	5	22,128,632 (GRCm38)	missense	possibly damaging	0.82
R4107:Reln	UTSW	5	22,034,584 (GRCm38)	missense	probably damaging	1.00
R4297:Reln	UTSW	5	21,920,487 (GRCm38)	missense	probably damaging	0.99
R4298:Reln	UTSW	5	21,920,487 (GRCm38)	missense	probably damaging	0.99
R4299:Reln	UTSW	5	21,920,487 (GRCm38)	missense	probably damaging	0.99
R4518:Reln	UTSW	5	21,901,743 (GRCm38)	missense	probably benign	0.44
R4615:Reln	UTSW	5	21,972,872 (GRCm38)	missense	possibly damaging	0.95
R4713:Reln	UTSW	5	22,152,463 (GRCm38)	missense	probably benign	0.17
R4720:Reln	UTSW	5	22,286,896 (GRCm38)	missense	possibly damaging	0.71
R4721:Reln	UTSW	5	21,919,222 (GRCm38)	missense	probably damaging	0.99
R4771:Reln	UTSW	5	22,049,700 (GRCm38)	missense	probably damaging	1.00
R4794:Reln	UTSW	5	22,344,185 (GRCm38)	missense	probably damaging	0.98
R4840:Reln	UTSW	5	22,018,846 (GRCm38)	splice site	probably null
R4860:Reln	UTSW	5	21,901,751 (GRCm38)	missense	probably benign	0.06
R4860:Reln	UTSW	5	21,901,751 (GRCm38)	missense	probably benign	0.06
R4896:Reln	UTSW	5	21,955,238 (GRCm38)	missense	probably damaging	1.00
R4908:Reln	UTSW	5	21,979,720 (GRCm38)	missense	probably benign	0.02
R4912:Reln	UTSW	5	21,925,193 (GRCm38)	missense	probably benign	0.29
R4922:Reln	UTSW	5	21,995,587 (GRCm38)	critical splice acceptor site	probably null
R4975:Reln	UTSW	5	21,960,426 (GRCm38)	missense	probably damaging	1.00
R4976:Reln	UTSW	5	21,971,870 (GRCm38)	missense	probably benign	0.05
R5020:Reln	UTSW	5	22,034,638 (GRCm38)	missense	probably damaging	1.00
R5037:Reln	UTSW	5	21,948,512 (GRCm38)	missense	probably damaging	1.00
R5082:Reln	UTSW	5	21,896,077 (GRCm38)	missense	probably benign	0.00
R5119:Reln	UTSW	5	21,971,870 (GRCm38)	missense	probably benign	0.05
R5125:Reln	UTSW	5	21,913,241 (GRCm38)	missense	possibly damaging	0.78
R5137:Reln	UTSW	5	21,955,181 (GRCm38)	missense	probably damaging	1.00
R5152:Reln	UTSW	5	21,948,629 (GRCm38)	missense	probably damaging	1.00
R5154:Reln	UTSW	5	21,988,765 (GRCm38)	missense	probably damaging	0.99
R5259:Reln	UTSW	5	22,103,397 (GRCm38)	missense	possibly damaging	0.83
R5283:Reln	UTSW	5	22,011,163 (GRCm38)	missense	probably damaging	1.00
R5386:Reln	UTSW	5	22,039,529 (GRCm38)	missense	probably benign
R5400:Reln	UTSW	5	21,979,714 (GRCm38)	missense	probably damaging	1.00
R5478:Reln	UTSW	5	22,004,203 (GRCm38)	missense	probably benign	0.00
R5514:Reln	UTSW	5	21,971,885 (GRCm38)	missense	possibly damaging	0.93
R5529:Reln	UTSW	5	21,932,715 (GRCm38)	missense	possibly damaging	0.71
R5611:Reln	UTSW	5	22,039,665 (GRCm38)	nonsense	probably null
R5648:Reln	UTSW	5	21,998,572 (GRCm38)	missense	probably benign	0.04
R5649:Reln	UTSW	5	21,901,625 (GRCm38)	missense	probably benign	0.33
R5744:Reln	UTSW	5	22,106,083 (GRCm38)	missense	probably null	0.39
R5782:Reln	UTSW	5	22,018,056 (GRCm38)	missense	probably benign	0.01
R5815:Reln	UTSW	5	21,947,433 (GRCm38)	missense	probably damaging	0.99
R5838:Reln	UTSW	5	21,899,113 (GRCm38)	missense	probably damaging	0.97
R6162:Reln	UTSW	5	21,911,050 (GRCm38)	missense	probably damaging	1.00
R6219:Reln	UTSW	5	21,948,596 (GRCm38)	missense	probably damaging	1.00
R6259:Reln	UTSW	5	22,060,333 (GRCm38)	missense	probably damaging	0.99
R6279:Reln	UTSW	5	21,896,841 (GRCm38)	missense	probably damaging	1.00
R6299:Reln	UTSW	5	22,286,944 (GRCm38)	missense	possibly damaging	0.71
R6300:Reln	UTSW	5	21,896,841 (GRCm38)	missense	probably damaging	1.00
R6314:Reln	UTSW	5	22,152,484 (GRCm38)	nonsense	probably null
R6351:Reln	UTSW	5	21,901,663 (GRCm38)	nonsense	probably null
R6369:Reln	UTSW	5	22,051,361 (GRCm38)	missense	probably benign	0.03
R6371:Reln	UTSW	5	21,995,513 (GRCm38)	missense	probably benign
R6374:Reln	UTSW	5	22,080,714 (GRCm38)	missense	probably benign	0.06
R6425:Reln	UTSW	5	21,911,020 (GRCm38)	nonsense	probably null
R6442:Reln	UTSW	5	21,932,776 (GRCm38)	missense	probably benign
R6445:Reln	UTSW	5	21,919,214 (GRCm38)	missense	probably benign	0.05
R6554:Reln	UTSW	5	21,896,840 (GRCm38)	missense	probably damaging	1.00
R6641:Reln	UTSW	5	21,929,134 (GRCm38)	missense	probably damaging	1.00
R6859:Reln	UTSW	5	22,034,570 (GRCm38)	missense	probably damaging	1.00
R6896:Reln	UTSW	5	21,899,179 (GRCm38)	missense	probably benign	0.18
R6932:Reln	UTSW	5	21,985,857 (GRCm38)	missense	probably benign	0.00
R6948:Reln	UTSW	5	21,972,035 (GRCm38)	missense	probably damaging	1.00
R6959:Reln	UTSW	5	21,976,564 (GRCm38)	missense	probably damaging	1.00
R7085:Reln	UTSW	5	21,915,087 (GRCm38)	nonsense	probably null
R7091:Reln	UTSW	5	21,899,029 (GRCm38)	missense	probably null	0.08
R7135:Reln	UTSW	5	21,976,596 (GRCm38)	missense	possibly damaging	0.95
R7146:Reln	UTSW	5	22,106,097 (GRCm38)	missense	probably damaging	0.97
R7167:Reln	UTSW	5	21,942,620 (GRCm38)	missense	probably damaging	1.00
R7190:Reln	UTSW	5	22,047,947 (GRCm38)	missense	probably damaging	1.00
R7256:Reln	UTSW	5	21,978,923 (GRCm38)	missense	probably benign	0.03
R7393:Reln	UTSW	5	21,976,351 (GRCm38)	missense	probably damaging	0.99
R7399:Reln	UTSW	5	22,051,367 (GRCm38)	missense	probably damaging	0.99
R7400:Reln	UTSW	5	21,971,934 (GRCm38)	missense	probably damaging	0.99
R7426:Reln	UTSW	5	21,971,953 (GRCm38)	missense	probably damaging	1.00
R7463:Reln	UTSW	5	22,103,435 (GRCm38)	missense	probably damaging	0.98
R7470:Reln	UTSW	5	21,942,741 (GRCm38)	missense	probably damaging	0.99
R7473:Reln	UTSW	5	21,929,127 (GRCm38)	missense	probably benign	0.25
R7501:Reln	UTSW	5	22,227,638 (GRCm38)	missense	possibly damaging	0.91
R7542:Reln	UTSW	5	21,955,181 (GRCm38)	missense	probably damaging	1.00
R7544:Reln	UTSW	5	21,976,278 (GRCm38)	nonsense	probably null
R7588:Reln	UTSW	5	21,885,568 (GRCm38)	missense	probably benign	0.03
R7631:Reln	UTSW	5	21,971,935 (GRCm38)	missense	probably damaging	0.97
R7644:Reln	UTSW	5	21,978,931 (GRCm38)	missense	probably benign	0.39
R7834:Reln	UTSW	5	22,039,635 (GRCm38)	missense	possibly damaging	0.94
R7923:Reln	UTSW	5	22,134,692 (GRCm38)	missense	probably benign	0.00
R7938:Reln	UTSW	5	21,950,872 (GRCm38)	missense	probably damaging	0.97
R8006:Reln	UTSW	5	21,899,084 (GRCm38)	nonsense	probably null
R8062:Reln	UTSW	5	21,971,992 (GRCm38)	missense	probably benign	0.00
R8222:Reln	UTSW	5	21,931,477 (GRCm38)	nonsense	probably null
R8266:Reln	UTSW	5	22,018,087 (GRCm38)	missense	possibly damaging	0.62
R8267:Reln	UTSW	5	22,004,112 (GRCm38)	missense	probably damaging	1.00
R8487:Reln	UTSW	5	21,899,029 (GRCm38)	missense	probably benign	0.03
R8523:Reln	UTSW	5	22,004,231 (GRCm38)	missense	probably damaging	1.00
R8751:Reln	UTSW	5	21,942,674 (GRCm38)	missense	probably benign	0.37
R8801:Reln	UTSW	5	21,950,856 (GRCm38)	missense	possibly damaging	0.94
R8802:Reln	UTSW	5	21,925,259 (GRCm38)	missense	probably damaging	0.98
R8978:Reln	UTSW	5	21,885,514 (GRCm38)	missense	possibly damaging	0.85
R8988:Reln	UTSW	5	21,899,157 (GRCm38)	missense	probably damaging	0.97
R8995:Reln	UTSW	5	21,979,579 (GRCm38)	missense	probably benign	0.00
R9022:Reln	UTSW	5	21,976,615 (GRCm38)	missense	possibly damaging	0.66
R9042:Reln	UTSW	5	22,048,038 (GRCm38)	missense	probably damaging	1.00
R9069:Reln	UTSW	5	22,011,061 (GRCm38)	missense	probably damaging	1.00
R9089:Reln	UTSW	5	21,925,200 (GRCm38)	missense	probably benign	0.01
R9126:Reln	UTSW	5	21,955,196 (GRCm38)	missense	probably damaging	1.00
R9172:Reln	UTSW	5	21,950,817 (GRCm38)	critical splice donor site	probably null
R9182:Reln	UTSW	5	21,901,619 (GRCm38)	missense	probably benign	0.44
R9196:Reln	UTSW	5	22,152,473 (GRCm38)	missense	probably damaging	1.00
R9211:Reln	UTSW	5	22,344,202 (GRCm38)	nonsense	probably null
R9241:Reln	UTSW	5	21,969,069 (GRCm38)	missense	probably damaging	0.99
R9244:Reln	UTSW	5	21,915,153 (GRCm38)	missense	probably damaging	0.99
R9281:Reln	UTSW	5	21,948,547 (GRCm38)	missense	probably damaging	1.00
R9295:Reln	UTSW	5	22,004,211 (GRCm38)	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	21,988,707 (GRCm38)	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	22,080,691 (GRCm38)	missense	probably benign	0.01
R9309:Reln	UTSW	5	21,971,868 (GRCm38)	missense	probably benign	0.37
R9338:Reln	UTSW	5	21,997,939 (GRCm38)	missense	probably damaging	0.98
R9381:Reln	UTSW	5	22,344,204 (GRCm38)	missense	possibly damaging	0.93
R9430:Reln	UTSW	5	21,915,107 (GRCm38)	missense	probably damaging	1.00
R9509:Reln	UTSW	5	22,344,200 (GRCm38)	missense	possibly damaging	0.93
R9515:Reln	UTSW	5	21,920,510 (GRCm38)	missense	possibly damaging	0.46
R9717:Reln	UTSW	5	21,931,429 (GRCm38)	missense	probably benign	0.26
R9745:Reln	UTSW	5	21,947,527 (GRCm38)	missense	probably damaging	1.00
R9778:Reln	UTSW	5	21,950,945 (GRCm38)	missense	probably damaging	1.00
Z1176:Reln	UTSW	5	21,979,024 (GRCm38)	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	22,004,082 (GRCm38)	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	21,969,241 (GRCm38)	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22,227,636 (GRCm38)	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	22,154,959 (GRCm38)	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GCGAGCACTATTCCCCATTG -3'
(R):5'- AGGCAATGTGCTCGCAATC -3'

Sequencing Primer
(F):5'- GCGAGCACTATTCCCCATTGAAATC -3'
(R):5'- TGTGCTCGCAATCATAAGCATC -3'

Posted On

2018-08-29