Mutagenetix > Incidental Mutations

Incidental Mutation 'R6768:Vmn2r61'

532043

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r61

Ensembl Gene

ENSMUSG00000090967

Gene Name

vomeronasal 2, receptor 61

Synonyms

EG637873, Casr-rs2, Gprc2a-rs2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R6768 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

42260053-42300755 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 42300324 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 723 (P723S)

Ref Sequence

ENSEMBL: ENSMUSP00000129576 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166131]

Predicted Effect

probably damaging
Transcript: ENSMUST00000166131
AA Change: P723S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129576
Gene: ENSMUSG00000090967
AA Change: P723S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	471	4e-42	PFAM
Pfam:NCD3G	514	567	1.9e-21	PFAM
Pfam:7tm_3	600	835	6.2e-52	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.9%
20x: 97.2%

Validation Efficiency

96% (45/47)

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110051M20Rik	A	T	2: 91,421,958	H19Q	probably damaging	Het
Adam6b	G	A	12: 113,490,243	V227I	probably benign	Het
Agtrap	A	G	4: 148,081,610	V106A	probably benign	Het
Aldh3a2	A	C	11: 61,253,710	S341A	probably benign	Het
Bmper	T	A	9: 23,381,453	C353S	probably damaging	Het
Casq1	C	T	1: 172,219,678	D5N	probably benign	Het
Ccin	G	A	4: 43,984,574	R327H	probably benign	Het
Chuk	A	G	19: 44,096,951	V252A	probably damaging	Het
Colec11	T	C	12: 28,595,101		probably null	Het
Cpeb3	G	A	19: 37,025,032	T643I	possibly damaging	Het
Ctcfl	A	G	2: 173,117,291	V214A	possibly damaging	Het
Dst	A	G	1: 34,181,712	E2199G	probably damaging	Het
Eno2	T	C	6: 124,767,748	E45G	probably damaging	Het
Foxa2	T	C	2: 148,043,827	H181R	probably damaging	Het
Fpgs	A	G	2: 32,686,623	S331P	probably benign	Het
Gm47189	A	G	14: 41,770,078	S81P	probably benign	Het
Igsf8	C	A	1: 172,317,532	P142Q	probably damaging	Het
Islr	G	T	9: 58,157,610	Q205K	possibly damaging	Het
Josd1	A	G	15: 79,677,122	W162R	probably benign	Het
Lrrc37a	G	A	11: 103,500,123	T1492I	probably benign	Het
Meox1	A	G	11: 101,879,335	F189L	probably damaging	Het
Mtf1	G	A	4: 124,837,785	D385N	probably benign	Het
Naip2	A	T	13: 100,178,324	C315*	probably null	Het
Ncaph2	T	A	15: 89,363,999	Y166*	probably null	Het
Nr1i3	G	A	1: 171,217,397	V270M	probably damaging	Het
Olfr155	T	C	4: 43,854,351	I14T	probably benign	Het
Olfr747	A	G	14: 50,681,592	L14S	probably damaging	Het
Panx3	T	C	9: 37,664,026	K180R	probably benign	Het
Pi4ka	A	G	16: 17,376,982	L184P	possibly damaging	Het
Reln	A	C	5: 21,978,907	V1698G	probably damaging	Het
Rnf213	G	T	11: 119,442,236	R2757L	probably damaging	Het
Scgb2b26	G	T	7: 33,944,954	T4K	probably damaging	Het
Sdhb	A	G	4: 140,979,053	E267G	probably damaging	Het
Sorbs1	A	T	19: 40,327,547	N383K	probably damaging	Het
Stk11ip	T	A	1: 75,532,635	C766S	probably benign	Het
Taf6l	A	C	19: 8,774,549	S592A	probably damaging	Het
Tmem145	G	A	7: 25,308,636	G235D	probably damaging	Het
Tuba3b	T	A	6: 145,618,729		probably null	Het
Ubl7	A	T	9: 57,912,762	E32D	probably benign	Het
Vmn1r168	A	T	7: 23,541,035	T106S	probably damaging	Het
Vmn2r59	C	A	7: 42,011,968	V808F	probably benign	Het
Wwc2	A	G	8: 47,900,791	Y103H	possibly damaging	Het
Zfp11	G	T	5: 129,658,351	D15E	probably benign	Het
Zfp428	G	A	7: 24,515,483	G162R	probably damaging	Het
Zfp629	G	A	7: 127,610,825	T604I	probably benign	Het
Zfpm1	C	A	8: 122,334,456	D253E	probably damaging	Het
Zhx1	G	T	15: 58,054,103	T249K	probably benign	Het

Other mutations in Vmn2r61

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Vmn2r61	APN	7	42300751	missense	possibly damaging	0.96
IGL00824:Vmn2r61	APN	7	42267014	missense	probably benign	0.03
IGL00903:Vmn2r61	APN	7	42300511	missense	probably damaging	1.00
IGL01125:Vmn2r61	APN	7	42260126	missense	probably damaging	1.00
IGL01393:Vmn2r61	APN	7	42266834	missense	probably benign	0.08
IGL01712:Vmn2r61	APN	7	42260237	missense	probably damaging	0.98
IGL01822:Vmn2r61	APN	7	42300706	missense	probably benign	0.18
IGL01835:Vmn2r61	APN	7	42300591	missense	probably benign	0.12
IGL01844:Vmn2r61	APN	7	42260215	missense	probably benign	0.00
IGL01953:Vmn2r61	APN	7	42300189	missense	probably damaging	1.00
IGL02032:Vmn2r61	APN	7	42300042	missense	probably damaging	0.99
IGL02054:Vmn2r61	APN	7	42276734	critical splice donor site	probably null
IGL02569:Vmn2r61	APN	7	42276646	missense	probably damaging	1.00
IGL02697:Vmn2r61	APN	7	42275468	missense	possibly damaging	0.55
IGL02958:Vmn2r61	APN	7	42299937	missense	probably benign
IGL03290:Vmn2r61	APN	7	42265984	missense	probably benign	0.00
IGL03337:Vmn2r61	APN	7	42267085	missense	possibly damaging	0.58
IGL03369:Vmn2r61	APN	7	42260093	missense	probably benign
IGL03402:Vmn2r61	APN	7	42260255	missense	probably benign
R0026:Vmn2r61	UTSW	7	42275474	missense	possibly damaging	0.64
R0319:Vmn2r61	UTSW	7	42300517	missense	probably damaging	0.99
R0433:Vmn2r61	UTSW	7	42265911	missense	probably benign	0.02
R0555:Vmn2r61	UTSW	7	42266018	missense	probably benign	0.02
R0691:Vmn2r61	UTSW	7	42300420	missense	probably damaging	1.00
R1701:Vmn2r61	UTSW	7	42300511	missense	probably damaging	1.00
R1718:Vmn2r61	UTSW	7	42300697	missense	probably benign
R1835:Vmn2r61	UTSW	7	42266652	nonsense	probably null
R1920:Vmn2r61	UTSW	7	42300286	missense	possibly damaging	0.73
R2069:Vmn2r61	UTSW	7	42300001	missense	probably benign	0.06
R2326:Vmn2r61	UTSW	7	42266863	missense	probably damaging	1.00
R2402:Vmn2r61	UTSW	7	42300105	missense	possibly damaging	0.90
R3103:Vmn2r61	UTSW	7	42266643	missense	possibly damaging	0.73
R3107:Vmn2r61	UTSW	7	42267067	missense	possibly damaging	0.82
R4426:Vmn2r61	UTSW	7	42300733	missense	probably benign
R4426:Vmn2r61	UTSW	7	42300735	missense	probably benign
R4484:Vmn2r61	UTSW	7	42300696	missense	probably benign
R4748:Vmn2r61	UTSW	7	42267141	missense	probably damaging	0.96
R4835:Vmn2r61	UTSW	7	42267035	missense	possibly damaging	0.52
R4863:Vmn2r61	UTSW	7	42300708	missense	probably benign	0.03
R4923:Vmn2r61	UTSW	7	42267096	missense	probably damaging	1.00
R4968:Vmn2r61	UTSW	7	42300054	missense	probably benign	0.14
R5114:Vmn2r61	UTSW	7	42300529	missense	possibly damaging	0.92
R5297:Vmn2r61	UTSW	7	42260222	missense	probably benign
R5497:Vmn2r61	UTSW	7	42275482	missense	possibly damaging	0.95
R5508:Vmn2r61	UTSW	7	42266818	missense	possibly damaging	0.52
R5587:Vmn2r61	UTSW	7	42300487	missense	probably damaging	1.00
R5615:Vmn2r61	UTSW	7	42300493	missense	probably damaging	1.00
R5615:Vmn2r61	UTSW	7	42267253	missense	probably benign	0.00
R5782:Vmn2r61	UTSW	7	42299829	missense	probably damaging	1.00
R6136:Vmn2r61	UTSW	7	42267031	missense	probably damaging	1.00
R6207:Vmn2r61	UTSW	7	42260192	missense	probably benign	0.01
R6265:Vmn2r61	UTSW	7	42266491	missense	probably benign	0.01
R6272:Vmn2r61	UTSW	7	42299818	missense	probably damaging	1.00
R6355:Vmn2r61	UTSW	7	42267235	missense	probably benign	0.00
R6469:Vmn2r61	UTSW	7	42265859	nonsense	probably null
R6554:Vmn2r61	UTSW	7	42276715	missense	probably damaging	1.00
R6699:Vmn2r61	UTSW	7	42300156	missense	probably benign
R6824:Vmn2r61	UTSW	7	42299979	missense	probably benign	0.10
R6930:Vmn2r61	UTSW	7	42299940	missense	probably benign	0.02
R7053:Vmn2r61	UTSW	7	42267133	missense	probably damaging	0.96
R7238:Vmn2r61	UTSW	7	42267205	missense	possibly damaging	0.73
R7332:Vmn2r61	UTSW	7	42260110	missense	probably benign	0.00
R7359:Vmn2r61	UTSW	7	42265983	missense	probably benign	0.11
R7553:Vmn2r61	UTSW	7	42266781	missense	not run
R7710:Vmn2r61	UTSW	7	42267048	missense	probably damaging	1.00
R7732:Vmn2r61	UTSW	7	42266673	missense	probably benign
R7839:Vmn2r61	UTSW	7	42266608	missense	probably damaging	0.97
R7922:Vmn2r61	UTSW	7	42266608	missense	probably damaging	0.97
Z1088:Vmn2r61	UTSW	7	42299964	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GACACACCCATTGTCAAGGC -3'
(R):5'- TGGCCTCATTGAAGGTGTCAG -3'

Sequencing Primer
(F):5'- AGGACTCTCAGCTACATCCTG -3'
(R):5'- CATTGAAGGTGTCAGGCAGATTCC -3'

Posted On

2018-08-29