Incidental Mutation 'R6769:Amer3'
ID532067
Institutional Source Beutler Lab
Gene Symbol Amer3
Ensembl Gene ENSMUSG00000045174
Gene NameAPC membrane recruitment 3
SynonymsFam123c, 9430069J07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6769 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location34579657-34590944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34588249 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 523 (A523D)
Ref Sequence ENSEMBL: ENSMUSP00000054748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052670]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052670
AA Change: A523D

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054748
Gene: ENSMUSG00000045174
AA Change: A523D

DomainStartEndE-ValueType
Pfam:WTX 138 444 1.6e-37 PFAM
low complexity region 506 523 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 98% (39/40)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,461,461 H174Q probably damaging Het
Alox5 C A 6: 116,415,184 probably null Het
Apoa4 G A 9: 46,243,167 M355I probably benign Het
Atp10b T C 11: 43,203,252 probably null Het
Atp9a A T 2: 168,674,900 Y340N probably damaging Het
C1rb T G 6: 124,577,405 S382A probably benign Het
Csmd1 A G 8: 16,071,394 V1763A possibly damaging Het
Ctnnd1 C A 2: 84,619,925 R317L probably damaging Het
Ctnnd1 A T 2: 84,620,110 D255E probably damaging Het
Dmxl2 A T 9: 54,416,524 I1192N probably damaging Het
Efcab5 A G 11: 77,105,432 V1101A probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam129b C T 2: 32,895,654 Het
Fam69b A G 2: 26,634,863 R92G probably benign Het
Flg T C 3: 93,288,323 probably benign Het
Fras1 A G 5: 96,598,941 I623M possibly damaging Het
Gm7361 T A 5: 26,257,769 L3* probably null Het
Gpr35 T A 1: 92,982,704 M46K probably damaging Het
Ighv2-9 A T 12: 113,879,310 F46I possibly damaging Het
Kdm4b C T 17: 56,351,754 A33V possibly damaging Het
Klhl5 T A 5: 65,164,652 Y534N probably damaging Het
Mccc1 C T 3: 35,989,843 probably null Het
Memo1 A T 17: 74,201,278 F270L probably damaging Het
Mnat1 A G 12: 73,272,422 N273S probably benign Het
Nxpe3 C A 16: 55,866,108 G179V probably damaging Het
Olfr1477 T A 19: 13,502,954 F204I possibly damaging Het
Otp A G 13: 94,875,786 D6G probably damaging Het
Prdm5 T A 6: 65,862,936 I265K probably damaging Het
Ptpn4 T A 1: 119,715,968 N350I probably benign Het
Rassf10 A G 7: 112,954,428 M79V probably benign Het
Rassf4 T A 6: 116,641,472 D215V possibly damaging Het
Rbm12 A T 2: 156,097,455 I299N possibly damaging Het
Scfd2 T C 5: 74,531,456 H55R probably benign Het
Scn8a A G 15: 101,035,564 N1550D probably benign Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc30a5 A C 13: 100,813,860 S240A probably benign Het
Slc7a4 A G 16: 17,575,320 V205A possibly damaging Het
Syde2 G A 3: 145,999,048 G318E probably damaging Het
Ttn T A 2: 76,708,539 D34649V possibly damaging Het
Vmn2r83 T A 10: 79,478,022 S155T probably damaging Het
Other mutations in Amer3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Amer3 APN 1 34588527 missense probably benign 0.26
IGL01062:Amer3 APN 1 34586739 missense probably damaging 0.96
IGL01501:Amer3 APN 1 34588317 missense probably benign
IGL02642:Amer3 APN 1 34586680 utr 5 prime probably benign
IGL02861:Amer3 APN 1 34588125 missense probably damaging 1.00
IGL02953:Amer3 APN 1 34587796 missense probably damaging 0.98
R0183:Amer3 UTSW 1 34587757 missense probably damaging 0.99
R0335:Amer3 UTSW 1 34579300 unclassified probably benign
R0639:Amer3 UTSW 1 34587821 nonsense probably null
R1391:Amer3 UTSW 1 34588389 missense probably benign 0.09
R1514:Amer3 UTSW 1 34579327 unclassified probably benign
R1615:Amer3 UTSW 1 34588171 missense probably damaging 0.99
R2014:Amer3 UTSW 1 34579444 unclassified probably benign
R2104:Amer3 UTSW 1 34588678 missense probably benign 0.00
R3080:Amer3 UTSW 1 34588422 missense probably benign 0.23
R4508:Amer3 UTSW 1 34588299 missense probably benign 0.00
R4635:Amer3 UTSW 1 34587877 missense probably damaging 1.00
R4978:Amer3 UTSW 1 34579300 unclassified probably benign
R4990:Amer3 UTSW 1 34588741 missense probably benign 0.17
R4991:Amer3 UTSW 1 34588741 missense probably benign 0.17
R5112:Amer3 UTSW 1 34587076 missense possibly damaging 0.94
R5645:Amer3 UTSW 1 34588381 missense possibly damaging 0.76
R6483:Amer3 UTSW 1 34587690 missense probably damaging 0.97
R7097:Amer3 UTSW 1 34588788 missense probably benign
R7246:Amer3 UTSW 1 34586728 missense possibly damaging 0.82
R7347:Amer3 UTSW 1 34587902 missense probably damaging 1.00
R7466:Amer3 UTSW 1 34587993 missense probably damaging 1.00
R7719:Amer3 UTSW 1 34589002 missense possibly damaging 0.55
R8158:Amer3 UTSW 1 34587660 missense possibly damaging 0.68
RF016:Amer3 UTSW 1 34587120 missense probably damaging 1.00
X0020:Amer3 UTSW 1 34588836 missense probably benign 0.00
Z1176:Amer3 UTSW 1 34589013 missense probably benign
Z1177:Amer3 UTSW 1 34587196 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGTCTATGTGCAGCTTCCG -3'
(R):5'- TTGCAGGCTCTCCTAAGACC -3'

Sequencing Primer
(F):5'- AGGAGAACCTGGCCCCAG -3'
(R):5'- GGCTCTCCTAAGACCTCACACTC -3'
Posted On2018-08-29