Incidental Mutation 'R6769:Kdm4b'
ID532104
Institutional Source Beutler Lab
Gene Symbol Kdm4b
Ensembl Gene ENSMUSG00000024201
Gene Namelysine (K)-specific demethylase 4B
SynonymsJmjd2b, 4732474L06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6769 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location56326062-56402870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 56351754 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 33 (A33V)
Ref Sequence ENSEMBL: ENSMUSP00000025036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025036] [ENSMUST00000086835] [ENSMUST00000139679]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025036
AA Change: A33V

PolyPhen 2 Score 0.537 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025036
Gene: ENSMUSG00000024201
AA Change: A33V

DomainStartEndE-ValueType
JmjN 14 56 5.88e-17 SMART
low complexity region 61 68 N/A INTRINSIC
JmjC 143 309 1.19e-59 SMART
low complexity region 349 361 N/A INTRINSIC
low complexity region 380 399 N/A INTRINSIC
low complexity region 443 449 N/A INTRINSIC
low complexity region 481 495 N/A INTRINSIC
low complexity region 511 537 N/A INTRINSIC
PHD 719 777 2.5e-5 SMART
PHD 839 895 7.07e-5 SMART
TUDOR 905 962 1.68e-9 SMART
TUDOR 963 1019 7.94e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086835
AA Change: A33V

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000084045
Gene: ENSMUSG00000024201
AA Change: A33V

DomainStartEndE-ValueType
JmjN 14 56 5.88e-17 SMART
low complexity region 61 68 N/A INTRINSIC
JmjC 143 309 1.19e-59 SMART
low complexity region 349 361 N/A INTRINSIC
low complexity region 380 399 N/A INTRINSIC
low complexity region 443 449 N/A INTRINSIC
low complexity region 481 495 N/A INTRINSIC
low complexity region 511 537 N/A INTRINSIC
PHD 712 770 2.5e-5 SMART
PHD 832 888 7.07e-5 SMART
TUDOR 898 954 2.31e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139679
AA Change: A33V

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000118089
Gene: ENSMUSG00000024201
AA Change: A33V

DomainStartEndE-ValueType
JmjN 14 56 5.88e-17 SMART
low complexity region 61 68 N/A INTRINSIC
Pfam:JmjC 176 208 5.8e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 98% (39/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele lacking demethylase activity exhibit no gross abnormalities. Mice homozygous for a conditional allele activated in mammary gland epithelial cells exhibit delayed mammary gland development with reduced branching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,461,461 H174Q probably damaging Het
Alox5 C A 6: 116,415,184 probably null Het
Amer3 C A 1: 34,588,249 A523D possibly damaging Het
Apoa4 G A 9: 46,243,167 M355I probably benign Het
Atp10b T C 11: 43,203,252 probably null Het
Atp9a A T 2: 168,674,900 Y340N probably damaging Het
C1rb T G 6: 124,577,405 S382A probably benign Het
Csmd1 A G 8: 16,071,394 V1763A possibly damaging Het
Ctnnd1 C A 2: 84,619,925 R317L probably damaging Het
Ctnnd1 A T 2: 84,620,110 D255E probably damaging Het
Dmxl2 A T 9: 54,416,524 I1192N probably damaging Het
Efcab5 A G 11: 77,105,432 V1101A probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fam129b C T 2: 32,895,654 Het
Fam69b A G 2: 26,634,863 R92G probably benign Het
Flg T C 3: 93,288,323 probably benign Het
Fras1 A G 5: 96,598,941 I623M possibly damaging Het
Gm7361 T A 5: 26,257,769 L3* probably null Het
Gpr35 T A 1: 92,982,704 M46K probably damaging Het
Ighv2-9 A T 12: 113,879,310 F46I possibly damaging Het
Klhl5 T A 5: 65,164,652 Y534N probably damaging Het
Mccc1 C T 3: 35,989,843 probably null Het
Memo1 A T 17: 74,201,278 F270L probably damaging Het
Mnat1 A G 12: 73,272,422 N273S probably benign Het
Nxpe3 C A 16: 55,866,108 G179V probably damaging Het
Olfr1477 T A 19: 13,502,954 F204I possibly damaging Het
Otp A G 13: 94,875,786 D6G probably damaging Het
Prdm5 T A 6: 65,862,936 I265K probably damaging Het
Ptpn4 T A 1: 119,715,968 N350I probably benign Het
Rassf10 A G 7: 112,954,428 M79V probably benign Het
Rassf4 T A 6: 116,641,472 D215V possibly damaging Het
Rbm12 A T 2: 156,097,455 I299N possibly damaging Het
Scfd2 T C 5: 74,531,456 H55R probably benign Het
Scn8a A G 15: 101,035,564 N1550D probably benign Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Slc30a5 A C 13: 100,813,860 S240A probably benign Het
Slc7a4 A G 16: 17,575,320 V205A possibly damaging Het
Syde2 G A 3: 145,999,048 G318E probably damaging Het
Ttn T A 2: 76,708,539 D34649V possibly damaging Het
Vmn2r83 T A 10: 79,478,022 S155T probably damaging Het
Other mutations in Kdm4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Kdm4b APN 17 56353019 missense probably benign 0.28
IGL01408:Kdm4b APN 17 56353518 splice site probably benign
IGL01610:Kdm4b APN 17 56353522 splice site probably benign
IGL01936:Kdm4b APN 17 56397355 missense probably damaging 1.00
IGL01964:Kdm4b APN 17 56389256 splice site probably null
IGL02151:Kdm4b APN 17 56396234 missense probably benign 0.05
IGL02596:Kdm4b APN 17 56399706 missense probably benign 0.14
IGL02975:Kdm4b APN 17 56375996 splice site probably null
IGL03172:Kdm4b APN 17 56401649 missense probably damaging 0.98
Coelestinum UTSW 17 56353091 missense probably benign 0.31
mistflower UTSW 17 56389564 missense possibly damaging 0.65
R0193:Kdm4b UTSW 17 56393952 missense probably benign 0.04
R0311:Kdm4b UTSW 17 56386200 missense probably benign 0.42
R0331:Kdm4b UTSW 17 56386289 splice site probably benign
R1109:Kdm4b UTSW 17 56399430 missense probably damaging 0.99
R1499:Kdm4b UTSW 17 56400025 missense probably damaging 1.00
R1895:Kdm4b UTSW 17 56397340 missense probably damaging 1.00
R1985:Kdm4b UTSW 17 56401302 missense probably damaging 1.00
R2087:Kdm4b UTSW 17 56389564 missense possibly damaging 0.65
R2185:Kdm4b UTSW 17 56393750 missense probably benign 0.00
R2904:Kdm4b UTSW 17 56355884 missense probably benign 0.03
R3792:Kdm4b UTSW 17 56355944 missense probably damaging 1.00
R3897:Kdm4b UTSW 17 56396955 missense probably damaging 1.00
R4661:Kdm4b UTSW 17 56399459 missense probably damaging 1.00
R4685:Kdm4b UTSW 17 56401675 missense probably benign 0.06
R4716:Kdm4b UTSW 17 56386178 missense probably benign 0.10
R4790:Kdm4b UTSW 17 56401618 missense probably damaging 0.97
R4864:Kdm4b UTSW 17 56353091 missense probably benign 0.31
R5700:Kdm4b UTSW 17 56351700 missense possibly damaging 0.93
R5963:Kdm4b UTSW 17 56399732 missense probably damaging 1.00
R6003:Kdm4b UTSW 17 56396916 missense probably damaging 1.00
R6029:Kdm4b UTSW 17 56396576 missense probably damaging 0.98
R6771:Kdm4b UTSW 17 56351754 missense possibly damaging 0.54
R6927:Kdm4b UTSW 17 56399435 missense probably damaging 1.00
R7041:Kdm4b UTSW 17 56396592 missense probably damaging 0.96
R7230:Kdm4b UTSW 17 56369155 missense probably damaging 1.00
R7275:Kdm4b UTSW 17 56396333 missense probably damaging 0.99
R7454:Kdm4b UTSW 17 56389639 missense probably benign 0.00
R7455:Kdm4b UTSW 17 56396657 missense probably damaging 0.98
R7457:Kdm4b UTSW 17 56396319 missense probably damaging 1.00
X0024:Kdm4b UTSW 17 56401278 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTATTTCGTTGCCTCCAAGG -3'
(R):5'- ACCTGGACTCCATCAGCTATTC -3'

Sequencing Primer
(F):5'- CAAGGGAGGCTTGGAGGTG -3'
(R):5'- AGCTATTCTTAGAGCCCTGGATCAG -3'
Posted On2018-08-29