Incidental Mutation 'R6770:Dnajc1'
ID532110
Institutional Source Beutler Lab
Gene Symbol Dnajc1
Ensembl Gene ENSMUSG00000026740
Gene NameDnaJ heat shock protein family (Hsp40) member C1
Synonyms4733401K02Rik, MTJ1, Dnajl1, D230036H06Rik, ERdj1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R6770 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location18195654-18392830 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 18217271 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028072] [ENSMUST00000028076] [ENSMUST00000091418] [ENSMUST00000114669] [ENSMUST00000114671] [ENSMUST00000166495]
Predicted Effect probably benign
Transcript: ENSMUST00000028072
SMART Domains Protein: ENSMUSP00000028072
Gene: ENSMUSG00000026740

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
DnaJ 60 104 5.4e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000028076
SMART Domains Protein: ENSMUSP00000028076
Gene: ENSMUSG00000026743

DomainStartEndE-ValueType
PHD 24 72 8.51e-8 SMART
PHD 136 195 2.92e-6 SMART
low complexity region 217 248 N/A INTRINSIC
low complexity region 258 274 N/A INTRINSIC
low complexity region 308 326 N/A INTRINSIC
low complexity region 352 372 N/A INTRINSIC
low complexity region 490 515 N/A INTRINSIC
low complexity region 581 594 N/A INTRINSIC
low complexity region 609 627 N/A INTRINSIC
low complexity region 674 692 N/A INTRINSIC
coiled coil region 741 782 N/A INTRINSIC
low complexity region 836 879 N/A INTRINSIC
low complexity region 941 952 N/A INTRINSIC
low complexity region 966 986 N/A INTRINSIC
low complexity region 997 1018 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000091418
AA Change: Q549K
SMART Domains Protein: ENSMUSP00000088980
Gene: ENSMUSG00000026740
AA Change: Q549K

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
DnaJ 60 117 5.73e-23 SMART
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 269 281 N/A INTRINSIC
SANT 324 375 2.06e-6 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
SANT 491 543 3.56e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114669
SMART Domains Protein: ENSMUSP00000110317
Gene: ENSMUSG00000026743

DomainStartEndE-ValueType
low complexity region 38 51 N/A INTRINSIC
low complexity region 66 84 N/A INTRINSIC
low complexity region 131 149 N/A INTRINSIC
coiled coil region 198 239 N/A INTRINSIC
low complexity region 293 336 N/A INTRINSIC
low complexity region 398 409 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 454 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114671
SMART Domains Protein: ENSMUSP00000110319
Gene: ENSMUSG00000026743

DomainStartEndE-ValueType
PHD 58 117 2.92e-6 SMART
low complexity region 139 170 N/A INTRINSIC
low complexity region 180 196 N/A INTRINSIC
low complexity region 230 248 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
low complexity region 412 437 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
low complexity region 531 549 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
coiled coil region 663 704 N/A INTRINSIC
low complexity region 758 801 N/A INTRINSIC
low complexity region 863 874 N/A INTRINSIC
low complexity region 888 908 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000148401
AA Change: Q54K
SMART Domains Protein: ENSMUSP00000132289
Gene: ENSMUSG00000026740
AA Change: Q54K

DomainStartEndE-ValueType
SANT 2 49 1.74e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163130
SMART Domains Protein: ENSMUSP00000129176
Gene: ENSMUSG00000026740

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
DnaJ 34 78 5.4e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164835
Predicted Effect unknown
Transcript: ENSMUST00000166495
AA Change: Q549K
SMART Domains Protein: ENSMUSP00000126321
Gene: ENSMUSG00000026740
AA Change: Q549K

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
DnaJ 60 117 5.73e-23 SMART
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 269 281 N/A INTRINSIC
SANT 324 375 2.06e-6 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 438 451 N/A INTRINSIC
SANT 491 543 3.56e-10 SMART
Predicted Effect unknown
Transcript: ENSMUST00000168723
AA Change: Q353K
SMART Domains Protein: ENSMUSP00000126716
Gene: ENSMUSG00000026740
AA Change: Q353K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
SANT 129 180 2.06e-6 SMART
low complexity region 221 239 N/A INTRINSIC
low complexity region 243 256 N/A INTRINSIC
SANT 296 348 3.56e-10 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a DNAJ-like heat shock protein that binds the molecular chaperone BiP. In addition, the encoded protein contains two SANT domains that have been shown to bind serpin alpha1-antichymotrypsin and inter-alpha trypsin inhibitor heavy chain 4. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adk A G 14: 21,234,914 K102E probably damaging Het
Bach2 G A 4: 32,575,240 V489I possibly damaging Het
Bin1 A G 18: 32,406,149 E45G probably damaging Het
Btnl4 A G 17: 34,474,037 Y135H probably benign Het
Btnl9 T C 11: 49,175,565 probably null Het
Cdh10 A G 15: 18,985,222 D324G probably benign Het
Cfi T C 3: 129,858,730 S269P probably benign Het
Ctbp1 G A 5: 33,250,860 Q243* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo39 T G 11: 72,317,796 S325A possibly damaging Het
Gbe1 T A 16: 70,314,265 L38Q possibly damaging Het
Gbe1 T C 16: 70,401,838 S140P probably damaging Het
Gm5114 T C 7: 39,408,543 S551G possibly damaging Het
Ina C T 19: 47,014,927 probably benign Het
Irs3 A G 5: 137,645,213 V103A possibly damaging Het
Ldb2 T A 5: 44,669,396 T66S probably damaging Het
Lrp4 C T 2: 91,497,303 A1499V probably benign Het
Nde1 G A 16: 14,188,378 V96I probably damaging Het
Nrap T C 19: 56,382,537 probably null Het
Nrxn1 G T 17: 90,037,179 N435K probably damaging Het
Obscn T C 11: 59,044,036 D5256G possibly damaging Het
Olfr1248 A G 2: 89,617,862 V110A probably benign Het
Olfr384 A G 11: 73,602,978 T133A probably benign Het
Olfr659 T A 7: 104,671,518 I272N probably damaging Het
Olfr892-ps1 T C 9: 38,190,183 F153L possibly damaging Het
Otoa T A 7: 121,145,614 M865K probably benign Het
Otud1 A G 2: 19,659,182 E374G probably benign Het
Pigz T A 16: 31,945,750 L542H probably damaging Het
Plekhg5 A G 4: 152,103,079 T101A probably benign Het
Ppic A T 18: 53,411,585 V51E probably benign Het
Ptpn14 G A 1: 189,832,773 V186M probably damaging Het
Ryr2 T A 13: 11,738,462 T1658S probably damaging Het
Scn7a T A 2: 66,729,184 probably null Het
Siva1 G A 12: 112,647,924 C73Y probably damaging Het
Slc4a1ap G A 5: 31,527,882 probably null Het
Sltm A G 9: 70,584,777 I683V unknown Het
Srgap2 A T 1: 131,298,510 C22S probably benign Het
Stxbp1 C T 2: 32,819,889 R64H probably benign Het
Suv39h2 T C 2: 3,472,551 N114S possibly damaging Het
Tas2r136 T C 6: 132,777,382 I261V probably benign Het
Trav14-2 A C 14: 53,641,172 H76P probably damaging Het
Ttc28 T C 5: 111,286,140 S2316P probably damaging Het
Ubr4 T C 4: 139,489,182 I5141T unknown Het
Usp46 A G 5: 74,032,354 V87A probably benign Het
Zfp423 T C 8: 87,781,817 N612S probably damaging Het
Other mutations in Dnajc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Dnajc1 APN 2 18308902 missense possibly damaging 0.80
IGL01301:Dnajc1 APN 2 18308834 missense probably damaging 0.99
IGL02080:Dnajc1 APN 2 18316348 intron probably benign
IGL03058:Dnajc1 APN 2 18217321 missense possibly damaging 0.90
ANU18:Dnajc1 UTSW 2 18308834 missense probably damaging 0.99
R0537:Dnajc1 UTSW 2 18307956 missense possibly damaging 0.63
R0630:Dnajc1 UTSW 2 18231801 missense probably damaging 1.00
R1187:Dnajc1 UTSW 2 18284709 missense probably benign 0.01
R1511:Dnajc1 UTSW 2 18222727 missense possibly damaging 0.88
R1844:Dnajc1 UTSW 2 18294027 nonsense probably null
R1848:Dnajc1 UTSW 2 18219713 missense probably damaging 1.00
R2174:Dnajc1 UTSW 2 18307951 missense probably damaging 0.99
R2199:Dnajc1 UTSW 2 18308899 missense probably damaging 1.00
R2211:Dnajc1 UTSW 2 18392475 missense probably damaging 0.99
R2471:Dnajc1 UTSW 2 18219816 missense possibly damaging 0.75
R4758:Dnajc1 UTSW 2 18308946 nonsense probably null
R5790:Dnajc1 UTSW 2 18307087 intron probably benign
R5802:Dnajc1 UTSW 2 18284739 missense probably benign 0.41
R5950:Dnajc1 UTSW 2 18306941 intron probably benign
R6049:Dnajc1 UTSW 2 18231700 splice site probably null
R7242:Dnajc1 UTSW 2 18293972 missense probably benign 0.06
R7462:Dnajc1 UTSW 2 18308899 missense probably damaging 0.99
R7716:Dnajc1 UTSW 2 18219873 missense probably benign 0.00
R7846:Dnajc1 UTSW 2 18219893 missense possibly damaging 0.56
R7929:Dnajc1 UTSW 2 18219893 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TGTAAATGGCACCTTACAGCATC -3'
(R):5'- GCTTCTTCATTAGGACTGGGC -3'

Sequencing Primer
(F):5'- GGCACCTTACAGCATCTATAATTG -3'
(R):5'- CTTCATTAGGACTGGGCAGTAACTC -3'
Posted On2018-08-29