Incidental Mutation 'R6770:Stxbp1'
ID532112
Institutional Source Beutler Lab
Gene Symbol Stxbp1
Ensembl Gene ENSMUSG00000026797
Gene Namesyntaxin binding protein 1
SynonymsRb-sec1, Munc18-1, Munc-18a, Sxtbp1, Unc18h, N-sec1, nsec1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.768) question?
Stock #R6770 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32787602-32847245 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32819889 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 64 (R64H)
Ref Sequence ENSEMBL: ENSMUSP00000089051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050000] [ENSMUST00000077458] [ENSMUST00000208840]
Predicted Effect probably benign
Transcript: ENSMUST00000050000
AA Change: R64H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000052440
Gene: ENSMUSG00000026797
AA Change: R64H

DomainStartEndE-ValueType
Pfam:Sec1 28 582 9.8e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077458
AA Change: R64H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000089051
Gene: ENSMUSG00000026797
AA Change: R64H

DomainStartEndE-ValueType
Pfam:Sec1 29 581 2.8e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208840
AA Change: R27H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a syntaxin-binding protein. The encoded protein appears to play a role in release of neurotransmitters via regulation of syntaxin, a transmembrane attachment protein receptor. Mutations in this gene have been associated with infantile epileptic encephalopathy-4. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit total loss of neurotransmitter secretion from synaptic vesicles throughout development and massive neuron apoptosis after initial synaptogenesis, leading to widespread neurodegeneration and complete neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adk A G 14: 21,234,914 K102E probably damaging Het
Bach2 G A 4: 32,575,240 V489I possibly damaging Het
Bin1 A G 18: 32,406,149 E45G probably damaging Het
Btnl4 A G 17: 34,474,037 Y135H probably benign Het
Btnl9 T C 11: 49,175,565 probably null Het
Cdh10 A G 15: 18,985,222 D324G probably benign Het
Cfi T C 3: 129,858,730 S269P probably benign Het
Ctbp1 G A 5: 33,250,860 Q243* probably null Het
Dnajc1 G T 2: 18,217,271 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo39 T G 11: 72,317,796 S325A possibly damaging Het
Gbe1 T A 16: 70,314,265 L38Q possibly damaging Het
Gbe1 T C 16: 70,401,838 S140P probably damaging Het
Gm5114 T C 7: 39,408,543 S551G possibly damaging Het
Ina C T 19: 47,014,927 probably benign Het
Irs3 A G 5: 137,645,213 V103A possibly damaging Het
Ldb2 T A 5: 44,669,396 T66S probably damaging Het
Lrp4 C T 2: 91,497,303 A1499V probably benign Het
Nde1 G A 16: 14,188,378 V96I probably damaging Het
Nrap T C 19: 56,382,537 probably null Het
Nrxn1 G T 17: 90,037,179 N435K probably damaging Het
Obscn T C 11: 59,044,036 D5256G possibly damaging Het
Olfr1248 A G 2: 89,617,862 V110A probably benign Het
Olfr384 A G 11: 73,602,978 T133A probably benign Het
Olfr659 T A 7: 104,671,518 I272N probably damaging Het
Olfr892-ps1 T C 9: 38,190,183 F153L possibly damaging Het
Otoa T A 7: 121,145,614 M865K probably benign Het
Otud1 A G 2: 19,659,182 E374G probably benign Het
Pigz T A 16: 31,945,750 L542H probably damaging Het
Plekhg5 A G 4: 152,103,079 T101A probably benign Het
Ppic A T 18: 53,411,585 V51E probably benign Het
Ptpn14 G A 1: 189,832,773 V186M probably damaging Het
Ryr2 T A 13: 11,738,462 T1658S probably damaging Het
Scn7a T A 2: 66,729,184 probably null Het
Siva1 G A 12: 112,647,924 C73Y probably damaging Het
Slc4a1ap G A 5: 31,527,882 probably null Het
Sltm A G 9: 70,584,777 I683V unknown Het
Srgap2 A T 1: 131,298,510 C22S probably benign Het
Suv39h2 T C 2: 3,472,551 N114S possibly damaging Het
Tas2r136 T C 6: 132,777,382 I261V probably benign Het
Trav14-2 A C 14: 53,641,172 H76P probably damaging Het
Ttc28 T C 5: 111,286,140 S2316P probably damaging Het
Ubr4 T C 4: 139,489,182 I5141T unknown Het
Usp46 A G 5: 74,032,354 V87A probably benign Het
Zfp423 T C 8: 87,781,817 N612S probably damaging Het
Other mutations in Stxbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Stxbp1 APN 2 32812064 missense probably benign 0.00
IGL02743:Stxbp1 APN 2 32819901 missense probably damaging 0.98
volume UTSW 2 32801893 missense probably damaging 0.99
volume2 UTSW 2 32801883 missense possibly damaging 0.95
P0021:Stxbp1 UTSW 2 32823538 missense probably damaging 0.96
R0217:Stxbp1 UTSW 2 32801870 missense possibly damaging 0.69
R0269:Stxbp1 UTSW 2 32802783 missense probably damaging 1.00
R0285:Stxbp1 UTSW 2 32823542 missense probably benign 0.00
R0335:Stxbp1 UTSW 2 32802905 splice site probably benign
R0565:Stxbp1 UTSW 2 32819848 missense probably benign 0.07
R0617:Stxbp1 UTSW 2 32802783 missense probably damaging 1.00
R0690:Stxbp1 UTSW 2 32800695 splice site probably benign
R1022:Stxbp1 UTSW 2 32814967 unclassified probably null
R1024:Stxbp1 UTSW 2 32814967 unclassified probably null
R1295:Stxbp1 UTSW 2 32794636 missense probably benign 0.18
R1296:Stxbp1 UTSW 2 32794636 missense probably benign 0.18
R1472:Stxbp1 UTSW 2 32794636 missense probably benign 0.18
R1699:Stxbp1 UTSW 2 32800617 missense probably damaging 0.99
R1744:Stxbp1 UTSW 2 32806719 critical splice donor site probably null
R2004:Stxbp1 UTSW 2 32798189 missense probably damaging 0.99
R2151:Stxbp1 UTSW 2 32802856 missense probably damaging 1.00
R2153:Stxbp1 UTSW 2 32802856 missense probably damaging 1.00
R2154:Stxbp1 UTSW 2 32802856 missense probably damaging 1.00
R5170:Stxbp1 UTSW 2 32794674 missense probably benign 0.01
R6083:Stxbp1 UTSW 2 32796018 missense possibly damaging 0.95
R6295:Stxbp1 UTSW 2 32794609 missense probably damaging 0.98
R6504:Stxbp1 UTSW 2 32801883 missense possibly damaging 0.95
R6954:Stxbp1 UTSW 2 32801893 missense probably damaging 0.99
R7283:Stxbp1 UTSW 2 32815014 missense probably damaging 1.00
R7382:Stxbp1 UTSW 2 32798168 missense probably damaging 1.00
R7541:Stxbp1 UTSW 2 32818505 missense probably damaging 0.99
R7734:Stxbp1 UTSW 2 32801820 missense probably benign 0.00
RF010:Stxbp1 UTSW 2 32821915 missense probably benign 0.06
X0060:Stxbp1 UTSW 2 32802768 missense probably damaging 1.00
Z1177:Stxbp1 UTSW 2 32802754 missense probably null 1.00
Z1177:Stxbp1 UTSW 2 32809128 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAAGAGCCCCACTTTCCCTG -3'
(R):5'- AAAAGCTCTTAGTGTAGTTGGGAG -3'

Sequencing Primer
(F):5'- GCTTCTGACAACATGCTTAACCTAG -3'
(R):5'- TCTAATACTGTGGTGAAGTGAAGC -3'
Posted On2018-08-29