Mutagenetix > Incidental Mutation

Incidental Mutation 'R6770:Cfi'

532116

Institutional Source

Beutler Lab

Gene Symbol

Cfi

Ensembl Gene

ENSMUSG00000058952

Gene Name

complement component factor i

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6770 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

129835884-129875332 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 129858730 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 269 (S269P)

Ref Sequence

ENSEMBL: ENSMUSP00000077074 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077918]

AlphaFold

Q61129

Predicted Effect

probably benign
Transcript: ENSMUST00000077918
AA Change: S269P

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000077074
Gene: ENSMUSG00000058952
AA Change: S269P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
FIMAC	45	111	4.63e-38	SMART
KAZAL	63	109	6.91e-3	SMART
SR	117	220	2.95e-22	SMART
LDLa	225	262	1.07e-4	SMART
LDLa	263	300	7.16e-6	SMART
low complexity region	317	326	N/A	INTRINSIC
Tryp_SPc	360	589	3.33e-71	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

100% (45/45)

MGI Phenotype

FUNCTION: This gene encodes a serine protease that plays an important role in the classical and alternative complement pathways where it cleaves C4b and C3b components of C3 and C5 convertases. The encoded preproprotein undergoes proteolytic processing to generate an active, disulfide-linked heterodimeric enzyme comprised of heavy and light chains. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous null mice display uncontrolled alternative pathway activation as shown by reduced complement C3, factor B, and factor H levels, but do not develop C3 deposition along the glomerular basement membrane or membranoproliferative glomerulonephritistype II. Plasma C3 circulates as C3b. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adk	A	G	14: 21,234,914	K102E	probably damaging	Het
Bach2	G	A	4: 32,575,240	V489I	possibly damaging	Het
Bin1	A	G	18: 32,406,149	E45G	probably damaging	Het
Btnl4	A	G	17: 34,474,037	Y135H	probably benign	Het
Btnl9	T	C	11: 49,175,565		probably null	Het
Cdh10	A	G	15: 18,985,222	D324G	probably benign	Het
Ctbp1	G	A	5: 33,250,860	Q243*	probably null	Het
Dnajc1	G	T	2: 18,217,271		probably benign	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fbxo39	T	G	11: 72,317,796	S325A	possibly damaging	Het
Gbe1	T	A	16: 70,314,265	L38Q	possibly damaging	Het
Gbe1	T	C	16: 70,401,838	S140P	probably damaging	Het
Gm5114	T	C	7: 39,408,543	S551G	possibly damaging	Het
Ina	C	T	19: 47,014,927		probably benign	Het
Irs3	A	G	5: 137,645,213	V103A	possibly damaging	Het
Ldb2	T	A	5: 44,669,396	T66S	probably damaging	Het
Lrp4	C	T	2: 91,497,303	A1499V	probably benign	Het
Nde1	G	A	16: 14,188,378	V96I	probably damaging	Het
Nrap	T	C	19: 56,382,537		probably null	Het
Nrxn1	G	T	17: 90,037,179	N435K	probably damaging	Het
Obscn	T	C	11: 59,044,036	D5256G	possibly damaging	Het
Olfr1248	A	G	2: 89,617,862	V110A	probably benign	Het
Olfr384	A	G	11: 73,602,978	T133A	probably benign	Het
Olfr659	T	A	7: 104,671,518	I272N	probably damaging	Het
Olfr892-ps1	T	C	9: 38,190,183	F153L	possibly damaging	Het
Otoa	T	A	7: 121,145,614	M865K	probably benign	Het
Otud1	A	G	2: 19,659,182	E374G	probably benign	Het
Pigz	T	A	16: 31,945,750	L542H	probably damaging	Het
Plekhg5	A	G	4: 152,103,079	T101A	probably benign	Het
Ppic	A	T	18: 53,411,585	V51E	probably benign	Het
Ptpn14	G	A	1: 189,832,773	V186M	probably damaging	Het
Ryr2	T	A	13: 11,738,462	T1658S	probably damaging	Het
Scn7a	T	A	2: 66,729,184		probably null	Het
Siva1	G	A	12: 112,647,924	C73Y	probably damaging	Het
Slc4a1ap	G	A	5: 31,527,882		probably null	Het
Sltm	A	G	9: 70,584,777	I683V	unknown	Het
Srgap2	A	T	1: 131,298,510	C22S	probably benign	Het
Stxbp1	C	T	2: 32,819,889	R64H	probably benign	Het
Suv39h2	T	C	2: 3,472,551	N114S	possibly damaging	Het
Tas2r136	T	C	6: 132,777,382	I261V	probably benign	Het
Trav14-2	A	C	14: 53,641,172	H76P	probably damaging	Het
Ttc28	T	C	5: 111,286,140	S2316P	probably damaging	Het
Ubr4	T	C	4: 139,489,182	I5141T	unknown	Het
Usp46	A	G	5: 74,032,354	V87A	probably benign	Het
Zfp423	T	C	8: 87,781,817	N612S	probably damaging	Het

Other mutations in Cfi

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Cfi	APN	3	129873095	missense	probably damaging	0.97
IGL00659:Cfi	APN	3	129836813	missense	unknown
IGL01310:Cfi	APN	3	129858431	missense	probably damaging	1.00
IGL01387:Cfi	APN	3	129874913	unclassified	probably benign
IGL01897:Cfi	APN	3	129858385	missense	probably damaging	1.00
IGL02418:Cfi	APN	3	129848812	missense	probably benign	0.20
F5770:Cfi	UTSW	3	129854992	missense	possibly damaging	0.62
R0085:Cfi	UTSW	3	129874986	missense	probably benign	0.00
R0102:Cfi	UTSW	3	129848767	missense	probably damaging	0.97
R0102:Cfi	UTSW	3	129848767	missense	probably damaging	0.97
R0835:Cfi	UTSW	3	129868542	missense	probably damaging	1.00
R1191:Cfi	UTSW	3	129868527	missense	probably benign	0.01
R1221:Cfi	UTSW	3	129872969	missense	probably damaging	0.99
R1576:Cfi	UTSW	3	129873050	missense	probably damaging	0.98
R1809:Cfi	UTSW	3	129873119	critical splice donor site	probably null
R1940:Cfi	UTSW	3	129858828	splice site	probably benign
R1983:Cfi	UTSW	3	129868545	missense	probably damaging	1.00
R2069:Cfi	UTSW	3	129858804	splice site	probably null
R3012:Cfi	UTSW	3	129874930	missense	probably damaging	1.00
R4334:Cfi	UTSW	3	129850829	missense	possibly damaging	0.80
R4596:Cfi	UTSW	3	129868500	missense	probably damaging	0.98
R4888:Cfi	UTSW	3	129873077	missense	probably damaging	1.00
R5121:Cfi	UTSW	3	129873077	missense	probably damaging	1.00
R5322:Cfi	UTSW	3	129873040	missense	probably damaging	1.00
R5673:Cfi	UTSW	3	129855009	missense	probably benign	0.02
R6084:Cfi	UTSW	3	129858370	missense	probably benign	0.00
R6364:Cfi	UTSW	3	129872846	missense	probably benign	0.36
R7000:Cfi	UTSW	3	129872873	missense	probably damaging	1.00
R7108:Cfi	UTSW	3	129875016	missense	probably damaging	1.00
R7194:Cfi	UTSW	3	129855059	missense	probably damaging	1.00
R7342:Cfi	UTSW	3	129875132	missense	probably damaging	1.00
R7470:Cfi	UTSW	3	129855087	missense	probably benign	0.01
R7538:Cfi	UTSW	3	129858815	missense	probably benign	0.08
R7908:Cfi	UTSW	3	129848584	missense	probably benign	0.01
R7954:Cfi	UTSW	3	129868585	critical splice donor site	probably null
R8017:Cfi	UTSW	3	129855099	missense	probably benign	0.00
R8135:Cfi	UTSW	3	129855000	missense	probably benign	0.00
R8155:Cfi	UTSW	3	129855090	missense	probably benign	0.00
R8217:Cfi	UTSW	3	129855001	missense	possibly damaging	0.61
R8530:Cfi	UTSW	3	129850733	missense	possibly damaging	0.79
R8767:Cfi	UTSW	3	129850848	critical splice donor site	probably null
R9578:Cfi	UTSW	3	129865375	missense	probably benign
R9590:Cfi	UTSW	3	129848812	missense	probably benign	0.02
R9774:Cfi	UTSW	3	129874996	missense	probably damaging	0.99
V7580:Cfi	UTSW	3	129854992	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- CACTAGGACTAAGAGCGTCACG -3'
(R):5'- TGGAGTAGAGCCACATAGACAC -3'

Sequencing Primer
(F):5'- AAATGTAAGCCCTCGTTTCACATGC -3'
(R):5'- GCCACATAGACACATAGAGACGTTTC -3'

Posted On

2018-08-29