Incidental Mutation 'R6770:Slc4a1ap'
ID532120
Institutional Source Beutler Lab
Gene Symbol Slc4a1ap
Ensembl Gene ENSMUSG00000029141
Gene Namesolute carrier family 4 (anion exchanger), member 1, adaptor protein
Synonymskanadaptin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.599) question?
Stock #R6770 (G1)
Quality Score195.009
Status Validated
Chromosome5
Chromosomal Location31526995-31556932 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 31527882 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065388] [ENSMUST00000114533] [ENSMUST00000200721] [ENSMUST00000201769] [ENSMUST00000201858] [ENSMUST00000202214] [ENSMUST00000202421] [ENSMUST00000202950]
Predicted Effect probably benign
Transcript: ENSMUST00000065388
SMART Domains Protein: ENSMUSP00000067337
Gene: ENSMUSG00000053134

DomainStartEndE-ValueType
low complexity region 79 89 N/A INTRINSIC
low complexity region 95 117 N/A INTRINSIC
BTP 149 228 5.13e-25 SMART
low complexity region 378 393 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114533
SMART Domains Protein: ENSMUSP00000110179
Gene: ENSMUSG00000029141

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 9e-41 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200721
SMART Domains Protein: ENSMUSP00000144294
Gene: ENSMUSG00000053134

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 46 68 N/A INTRINSIC
BTP 100 179 5.13e-25 SMART
low complexity region 329 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201769
SMART Domains Protein: ENSMUSP00000144065
Gene: ENSMUSG00000053134

DomainStartEndE-ValueType
low complexity region 79 89 N/A INTRINSIC
low complexity region 95 117 N/A INTRINSIC
BTP 149 228 5.13e-25 SMART
low complexity region 378 393 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000201858
SMART Domains Protein: ENSMUSP00000143960
Gene: ENSMUSG00000029141

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 2e-41 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202214
SMART Domains Protein: ENSMUSP00000144613
Gene: ENSMUSG00000029141

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 9e-41 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 666 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202421
SMART Domains Protein: ENSMUSP00000143795
Gene: ENSMUSG00000053134

DomainStartEndE-ValueType
low complexity region 79 89 N/A INTRINSIC
low complexity region 95 117 N/A INTRINSIC
BTP 149 228 5.13e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000202950
SMART Domains Protein: ENSMUSP00000144257
Gene: ENSMUSG00000029141

DomainStartEndE-ValueType
FHA 134 195 3.21e-13 SMART
Blast:DSRM 316 385 1e-40 BLAST
low complexity region 405 419 N/A INTRINSIC
coiled coil region 443 475 N/A INTRINSIC
coiled coil region 588 619 N/A INTRINSIC
low complexity region 622 631 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adk A G 14: 21,234,914 K102E probably damaging Het
Bach2 G A 4: 32,575,240 V489I possibly damaging Het
Bin1 A G 18: 32,406,149 E45G probably damaging Het
Btnl4 A G 17: 34,474,037 Y135H probably benign Het
Btnl9 T C 11: 49,175,565 probably null Het
Cdh10 A G 15: 18,985,222 D324G probably benign Het
Cfi T C 3: 129,858,730 S269P probably benign Het
Ctbp1 G A 5: 33,250,860 Q243* probably null Het
Dnajc1 G T 2: 18,217,271 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo39 T G 11: 72,317,796 S325A possibly damaging Het
Gbe1 T A 16: 70,314,265 L38Q possibly damaging Het
Gbe1 T C 16: 70,401,838 S140P probably damaging Het
Gm5114 T C 7: 39,408,543 S551G possibly damaging Het
Ina C T 19: 47,014,927 probably benign Het
Irs3 A G 5: 137,645,213 V103A possibly damaging Het
Ldb2 T A 5: 44,669,396 T66S probably damaging Het
Lrp4 C T 2: 91,497,303 A1499V probably benign Het
Nde1 G A 16: 14,188,378 V96I probably damaging Het
Nrap T C 19: 56,382,537 probably null Het
Nrxn1 G T 17: 90,037,179 N435K probably damaging Het
Obscn T C 11: 59,044,036 D5256G possibly damaging Het
Olfr1248 A G 2: 89,617,862 V110A probably benign Het
Olfr384 A G 11: 73,602,978 T133A probably benign Het
Olfr659 T A 7: 104,671,518 I272N probably damaging Het
Olfr892-ps1 T C 9: 38,190,183 F153L possibly damaging Het
Otoa T A 7: 121,145,614 M865K probably benign Het
Otud1 A G 2: 19,659,182 E374G probably benign Het
Pigz T A 16: 31,945,750 L542H probably damaging Het
Plekhg5 A G 4: 152,103,079 T101A probably benign Het
Ppic A T 18: 53,411,585 V51E probably benign Het
Ptpn14 G A 1: 189,832,773 V186M probably damaging Het
Ryr2 T A 13: 11,738,462 T1658S probably damaging Het
Scn7a T A 2: 66,729,184 probably null Het
Siva1 G A 12: 112,647,924 C73Y probably damaging Het
Sltm A G 9: 70,584,777 I683V unknown Het
Srgap2 A T 1: 131,298,510 C22S probably benign Het
Stxbp1 C T 2: 32,819,889 R64H probably benign Het
Suv39h2 T C 2: 3,472,551 N114S possibly damaging Het
Tas2r136 T C 6: 132,777,382 I261V probably benign Het
Trav14-2 A C 14: 53,641,172 H76P probably damaging Het
Ttc28 T C 5: 111,286,140 S2316P probably damaging Het
Ubr4 T C 4: 139,489,182 I5141T unknown Het
Usp46 A G 5: 74,032,354 V87A probably benign Het
Zfp423 T C 8: 87,781,817 N612S probably damaging Het
Other mutations in Slc4a1ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Slc4a1ap APN 5 31553777 missense probably damaging 1.00
IGL01526:Slc4a1ap APN 5 31528227 missense possibly damaging 0.86
R1556:Slc4a1ap UTSW 5 31534210 splice site probably null
R1694:Slc4a1ap UTSW 5 31543754 missense probably damaging 1.00
R1884:Slc4a1ap UTSW 5 31534180 missense probably damaging 1.00
R3787:Slc4a1ap UTSW 5 31528139 missense possibly damaging 0.92
R4510:Slc4a1ap UTSW 5 31527403 missense probably benign 0.00
R4511:Slc4a1ap UTSW 5 31527403 missense probably benign 0.00
R4562:Slc4a1ap UTSW 5 31532029 missense probably damaging 1.00
R4828:Slc4a1ap UTSW 5 31530709 nonsense probably null
R5611:Slc4a1ap UTSW 5 31553829 utr 3 prime probably benign
R5648:Slc4a1ap UTSW 5 31550785 splice site probably null
R5991:Slc4a1ap UTSW 5 31534069 missense possibly damaging 0.92
R6531:Slc4a1ap UTSW 5 31548638 missense probably benign 0.18
R6602:Slc4a1ap UTSW 5 31527641 missense probably damaging 1.00
R6844:Slc4a1ap UTSW 5 31527478 missense probably damaging 1.00
R7103:Slc4a1ap UTSW 5 31543857 missense probably benign
R7342:Slc4a1ap UTSW 5 31536290 missense possibly damaging 0.89
R7378:Slc4a1ap UTSW 5 31527527 missense probably benign
R7527:Slc4a1ap UTSW 5 31534131 missense probably benign 0.04
R7603:Slc4a1ap UTSW 5 31546195 missense
R7608:Slc4a1ap UTSW 5 31536189 missense possibly damaging 0.51
R7781:Slc4a1ap UTSW 5 31527478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAATGCGCTTTGGAGGCAG -3'
(R):5'- CTCTGGTCCCTAATGAATCATGG -3'

Sequencing Primer
(F):5'- TTTGGAGGCAGCACTCG -3'
(R):5'- GAATGAGGCCTGTGCTTT -3'
Posted On2018-08-29