Incidental Mutation 'R6770:Olfr384'
ID532137
Institutional Source Beutler Lab
Gene Symbol Olfr384
Ensembl Gene ENSMUSG00000060335
Gene Nameolfactory receptor 384
SynonymsOlfr386, GA_x6K02T2P1NL-3739520-3740032, GA_x6K02T2P1NL-3773152-3774090, MOR135-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R6770 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73598594-73605092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73602978 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 133 (T133A)
Ref Sequence ENSEMBL: ENSMUSP00000148997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072993] [ENSMUST00000214228]
Predicted Effect probably benign
Transcript: ENSMUST00000072993
AA Change: T133A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000072758
Gene: ENSMUSG00000060335
AA Change: T133A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-60 PFAM
Pfam:7TM_GPCR_Srsx 35 305 5.6e-9 PFAM
Pfam:7tm_1 41 290 1.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214228
AA Change: T133A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adk A G 14: 21,234,914 K102E probably damaging Het
Bach2 G A 4: 32,575,240 V489I possibly damaging Het
Bin1 A G 18: 32,406,149 E45G probably damaging Het
Btnl4 A G 17: 34,474,037 Y135H probably benign Het
Btnl9 T C 11: 49,175,565 probably null Het
Cdh10 A G 15: 18,985,222 D324G probably benign Het
Cfi T C 3: 129,858,730 S269P probably benign Het
Ctbp1 G A 5: 33,250,860 Q243* probably null Het
Dnajc1 G T 2: 18,217,271 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo39 T G 11: 72,317,796 S325A possibly damaging Het
Gbe1 T A 16: 70,314,265 L38Q possibly damaging Het
Gbe1 T C 16: 70,401,838 S140P probably damaging Het
Gm5114 T C 7: 39,408,543 S551G possibly damaging Het
Ina C T 19: 47,014,927 probably benign Het
Irs3 A G 5: 137,645,213 V103A possibly damaging Het
Ldb2 T A 5: 44,669,396 T66S probably damaging Het
Lrp4 C T 2: 91,497,303 A1499V probably benign Het
Nde1 G A 16: 14,188,378 V96I probably damaging Het
Nrap T C 19: 56,382,537 probably null Het
Nrxn1 G T 17: 90,037,179 N435K probably damaging Het
Obscn T C 11: 59,044,036 D5256G possibly damaging Het
Olfr1248 A G 2: 89,617,862 V110A probably benign Het
Olfr659 T A 7: 104,671,518 I272N probably damaging Het
Olfr892-ps1 T C 9: 38,190,183 F153L possibly damaging Het
Otoa T A 7: 121,145,614 M865K probably benign Het
Otud1 A G 2: 19,659,182 E374G probably benign Het
Pigz T A 16: 31,945,750 L542H probably damaging Het
Plekhg5 A G 4: 152,103,079 T101A probably benign Het
Ppic A T 18: 53,411,585 V51E probably benign Het
Ptpn14 G A 1: 189,832,773 V186M probably damaging Het
Ryr2 T A 13: 11,738,462 T1658S probably damaging Het
Scn7a T A 2: 66,729,184 probably null Het
Siva1 G A 12: 112,647,924 C73Y probably damaging Het
Slc4a1ap G A 5: 31,527,882 probably null Het
Sltm A G 9: 70,584,777 I683V unknown Het
Srgap2 A T 1: 131,298,510 C22S probably benign Het
Stxbp1 C T 2: 32,819,889 R64H probably benign Het
Suv39h2 T C 2: 3,472,551 N114S possibly damaging Het
Tas2r136 T C 6: 132,777,382 I261V probably benign Het
Trav14-2 A C 14: 53,641,172 H76P probably damaging Het
Ttc28 T C 5: 111,286,140 S2316P probably damaging Het
Ubr4 T C 4: 139,489,182 I5141T unknown Het
Usp46 A G 5: 74,032,354 V87A probably benign Het
Zfp423 T C 8: 87,781,817 N612S probably damaging Het
Other mutations in Olfr384
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Olfr384 APN 11 73603230 missense probably damaging 1.00
IGL01767:Olfr384 APN 11 73603032 missense probably benign
IGL02296:Olfr384 APN 11 73602706 missense probably damaging 1.00
IGL02327:Olfr384 APN 11 73603155 missense probably damaging 1.00
IGL02740:Olfr384 APN 11 73602831 missense probably benign 0.41
H8562:Olfr384 UTSW 11 73603447 missense probably damaging 1.00
R0594:Olfr384 UTSW 11 73603392 missense probably benign 0.03
R2038:Olfr384 UTSW 11 73603413 missense probably damaging 1.00
R2127:Olfr384 UTSW 11 73602805 missense possibly damaging 0.78
R2844:Olfr384 UTSW 11 73603383 missense probably benign 0.12
R2846:Olfr384 UTSW 11 73603383 missense probably benign 0.12
R3877:Olfr384 UTSW 11 73603153 missense probably damaging 1.00
R4193:Olfr384 UTSW 11 73603417 missense probably damaging 1.00
R4433:Olfr384 UTSW 11 73602886 missense probably damaging 1.00
R4824:Olfr384 UTSW 11 73602600 missense possibly damaging 0.61
R4851:Olfr384 UTSW 11 73603057 missense probably damaging 1.00
R5285:Olfr384 UTSW 11 73602941 nonsense probably null
R5326:Olfr384 UTSW 11 73603204 missense possibly damaging 0.94
R5542:Olfr384 UTSW 11 73603204 missense possibly damaging 0.94
R5662:Olfr384 UTSW 11 73603179 missense probably benign 0.03
R6489:Olfr384 UTSW 11 73603439 missense probably damaging 1.00
R7131:Olfr384 UTSW 11 73602736 missense possibly damaging 0.78
R7313:Olfr384 UTSW 11 73602984 missense probably damaging 0.99
R7754:Olfr384 UTSW 11 73603506 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAATGCCCAAATTGCTGC -3'
(R):5'- GCACCACAGTATCAAGTGTTC -3'

Sequencing Primer
(F):5'- TTGCTGCAGAACATTCAGAGC -3'
(R):5'- CATTAATATAAGTGTCAGAGCAGGCC -3'
Posted On2018-08-29