Incidental Mutation 'R6770:Trav14-2'
ID 532141
Institutional Source Beutler Lab
Gene Symbol Trav14-2
Ensembl Gene ENSMUSG00000095711
Gene Name T cell receptor alpha variable 14-2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R6770 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 53640701-53641224 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 53641172 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Proline at position 76 (H76P)
Ref Sequence ENSEMBL: ENSMUSP00000139225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179267] [ENSMUST00000184874]
AlphaFold A0A0B4J1N7
Predicted Effect probably damaging
Transcript: ENSMUST00000179267
AA Change: H104P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136351
Gene: ENSMUSG00000095711
AA Change: H104P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGv 46 120 4.35e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184874
AA Change: H76P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139225
Gene: ENSMUSG00000095711
AA Change: H76P

DomainStartEndE-ValueType
IGv 18 92 4.35e-13 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (45/45)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adk A G 14: 21,234,914 K102E probably damaging Het
Bach2 G A 4: 32,575,240 V489I possibly damaging Het
Bin1 A G 18: 32,406,149 E45G probably damaging Het
Btnl4 A G 17: 34,474,037 Y135H probably benign Het
Btnl9 T C 11: 49,175,565 probably null Het
Cdh10 A G 15: 18,985,222 D324G probably benign Het
Cfi T C 3: 129,858,730 S269P probably benign Het
Ctbp1 G A 5: 33,250,860 Q243* probably null Het
Dnajc1 G T 2: 18,217,271 probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo39 T G 11: 72,317,796 S325A possibly damaging Het
Gbe1 T A 16: 70,314,265 L38Q possibly damaging Het
Gbe1 T C 16: 70,401,838 S140P probably damaging Het
Gm5114 T C 7: 39,408,543 S551G possibly damaging Het
Ina C T 19: 47,014,927 probably benign Het
Irs3 A G 5: 137,645,213 V103A possibly damaging Het
Ldb2 T A 5: 44,669,396 T66S probably damaging Het
Lrp4 C T 2: 91,497,303 A1499V probably benign Het
Nde1 G A 16: 14,188,378 V96I probably damaging Het
Nrap T C 19: 56,382,537 probably null Het
Nrxn1 G T 17: 90,037,179 N435K probably damaging Het
Obscn T C 11: 59,044,036 D5256G possibly damaging Het
Olfr1248 A G 2: 89,617,862 V110A probably benign Het
Olfr384 A G 11: 73,602,978 T133A probably benign Het
Olfr659 T A 7: 104,671,518 I272N probably damaging Het
Olfr892-ps1 T C 9: 38,190,183 F153L possibly damaging Het
Otoa T A 7: 121,145,614 M865K probably benign Het
Otud1 A G 2: 19,659,182 E374G probably benign Het
Pigz T A 16: 31,945,750 L542H probably damaging Het
Plekhg5 A G 4: 152,103,079 T101A probably benign Het
Ppic A T 18: 53,411,585 V51E probably benign Het
Ptpn14 G A 1: 189,832,773 V186M probably damaging Het
Ryr2 T A 13: 11,738,462 T1658S probably damaging Het
Scn7a T A 2: 66,729,184 probably null Het
Siva1 G A 12: 112,647,924 C73Y probably damaging Het
Slc4a1ap G A 5: 31,527,882 probably null Het
Sltm A G 9: 70,584,777 I683V unknown Het
Srgap2 A T 1: 131,298,510 C22S probably benign Het
Stxbp1 C T 2: 32,819,889 R64H probably benign Het
Suv39h2 T C 2: 3,472,551 N114S possibly damaging Het
Tas2r136 T C 6: 132,777,382 I261V probably benign Het
Ttc28 T C 5: 111,286,140 S2316P probably damaging Het
Ubr4 T C 4: 139,489,182 I5141T unknown Het
Usp46 A G 5: 74,032,354 V87A probably benign Het
Zfp423 T C 8: 87,781,817 N612S probably damaging Het
Other mutations in Trav14-2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4755:Trav14-2 UTSW 14 53640780 unclassified probably benign
R5027:Trav14-2 UTSW 14 53641048 missense probably damaging 1.00
R7445:Trav14-2 UTSW 14 53641058 missense probably damaging 0.96
R7877:Trav14-2 UTSW 14 53641051 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GACAGCAATTCTGAACTGCAG -3'
(R):5'- GGTCTGTCTTTGGCCCAATG -3'

Sequencing Primer
(F):5'- GCAGTTATGAGGACAGCACTTTTGAC -3'
(R):5'- ATGGTCTAATCCTTACACTCACTGAG -3'
Posted On 2018-08-29