Incidental Mutation 'R6771:Ptpn4'
ID532154
Institutional Source Beutler Lab
Gene Symbol Ptpn4
Ensembl Gene ENSMUSG00000026384
Gene Nameprotein tyrosine phosphatase, non-receptor type 4
SynonymsTEP/mPTPMEG, PTPMEG, TEP, testis-enriched phosphatase, hPTP-MEG, protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R6771 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location119652467-119837613 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119715968 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 350 (N350I)
Ref Sequence ENSEMBL: ENSMUSP00000127713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064091] [ENSMUST00000163435]
Predicted Effect probably benign
Transcript: ENSMUST00000064091
AA Change: N350I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000067614
Gene: ENSMUSG00000026384
AA Change: N350I

DomainStartEndE-ValueType
B41 25 222 7.33e-80 SMART
FERM_C 226 316 6.48e-34 SMART
FA 322 368 3.28e-12 SMART
PDZ 526 605 2.47e-14 SMART
PTPc 654 913 1.38e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163435
AA Change: N350I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000127713
Gene: ENSMUSG00000026384
AA Change: N350I

DomainStartEndE-ValueType
B41 25 222 7.33e-80 SMART
FERM_C 226 316 6.48e-34 SMART
FA 322 368 3.28e-12 SMART
PDB:3NFL|D 499 552 4e-30 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000164269
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.3%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. This PTP has been shown to interact with glutamate receptor delta 2 and epsilon subunits, and is thought to play a role in signalling downstream of the glutamate receptors through tyrosine dephosphorylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired coordination, abnormal eye blink conditioning behavior, and reduced long term depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,461,461 H174Q probably damaging Het
Apoa4 G A 9: 46,243,167 M355I probably benign Het
Apol8 A T 15: 77,753,058 probably null Het
Arvcf A G 16: 18,403,864 T792A probably benign Het
Atp10b T C 11: 43,203,252 probably null Het
Atp9a A T 2: 168,674,900 Y340N probably damaging Het
C1rb T G 6: 124,577,405 S382A probably benign Het
Clmn A G 12: 104,773,782 V962A probably benign Het
Csmd1 A G 8: 16,071,394 V1763A possibly damaging Het
Ctnnd1 C A 2: 84,619,925 R317L probably damaging Het
Ctnnd1 A T 2: 84,620,110 D255E probably damaging Het
Cyb5a T A 18: 84,871,630 H61Q probably damaging Het
Dmxl2 A T 9: 54,416,524 I1192N probably damaging Het
Fam69b A G 2: 26,634,863 R92G probably benign Het
Flg T C 3: 93,288,323 probably benign Het
Fras1 A G 5: 96,598,941 I623M possibly damaging Het
Ftsj3 T C 11: 106,249,540 K801E probably damaging Het
Gpr35 T A 1: 92,982,704 M46K probably damaging Het
Ighv2-9 T G 12: 113,879,187 S87R probably damaging Het
Kdm4b C T 17: 56,351,754 A33V possibly damaging Het
Klhl5 T A 5: 65,164,652 Y534N probably damaging Het
March8 T C 6: 116,402,043 S313P probably benign Het
Mccc1 C T 3: 35,989,843 probably null Het
Memo1 A T 17: 74,201,278 F270L probably damaging Het
Nxpe3 C A 16: 55,866,108 G179V probably damaging Het
Olfr1477 T A 19: 13,502,954 F204I possibly damaging Het
Olfr726 C A 14: 50,083,989 A231S probably damaging Het
Olfr855 C T 9: 19,585,379 L281F probably benign Het
Otp A G 13: 94,875,786 D6G probably damaging Het
Pwp2 G A 10: 78,182,388 probably null Het
Rassf10 A G 7: 112,954,428 M79V probably benign Het
Rbm12 A T 2: 156,097,455 I299N possibly damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Homo
Scfd2 T C 5: 74,531,456 H55R probably benign Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Sp110 C T 1: 85,592,279 probably null Het
Syde2 G A 3: 145,999,048 G318E probably damaging Het
Ttn T A 2: 76,708,539 D34649V possibly damaging Het
Other mutations in Ptpn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Ptpn4 APN 1 119659925 splice site probably benign
IGL00885:Ptpn4 APN 1 119802363 missense possibly damaging 0.95
IGL00973:Ptpn4 APN 1 119741371 missense probably benign 0.00
IGL01867:Ptpn4 APN 1 119675599 missense probably benign
IGL01870:Ptpn4 APN 1 119675547 critical splice donor site probably null
IGL02101:Ptpn4 APN 1 119687678 missense probably damaging 1.00
IGL02344:Ptpn4 APN 1 119773260 missense probably damaging 1.00
IGL02348:Ptpn4 APN 1 119682722 missense probably damaging 1.00
IGL02693:Ptpn4 APN 1 119715969 missense probably damaging 0.96
IGL03281:Ptpn4 APN 1 119659912 missense probably damaging 1.00
botched UTSW 1 119743390 missense probably damaging 1.00
bungled UTSW 1 119687605 splice site probably null
hash UTSW 1 119765919 nonsense probably null
R0105:Ptpn4 UTSW 1 119687605 splice site probably null
R0105:Ptpn4 UTSW 1 119687605 splice site probably null
R0504:Ptpn4 UTSW 1 119765915 missense probably damaging 1.00
R1148:Ptpn4 UTSW 1 119684540 missense probably damaging 0.99
R1148:Ptpn4 UTSW 1 119675709 splice site probably benign
R1148:Ptpn4 UTSW 1 119684540 missense probably damaging 0.99
R1662:Ptpn4 UTSW 1 119765058 missense probably damaging 0.96
R1694:Ptpn4 UTSW 1 119783510 missense probably damaging 0.99
R1733:Ptpn4 UTSW 1 119716043 intron probably null
R2083:Ptpn4 UTSW 1 119687759 missense possibly damaging 0.63
R2226:Ptpn4 UTSW 1 119682785 missense probably damaging 1.00
R2276:Ptpn4 UTSW 1 119684591 missense probably damaging 1.00
R2277:Ptpn4 UTSW 1 119684591 missense probably damaging 1.00
R3123:Ptpn4 UTSW 1 119765423 splice site probably null
R3425:Ptpn4 UTSW 1 119707830 missense probably benign 0.02
R4568:Ptpn4 UTSW 1 119680059 missense probably damaging 1.00
R4716:Ptpn4 UTSW 1 119721868 missense probably damaging 1.00
R4819:Ptpn4 UTSW 1 119659850 missense probably benign
R4959:Ptpn4 UTSW 1 119765096 nonsense probably null
R5161:Ptpn4 UTSW 1 119707863 nonsense probably null
R5345:Ptpn4 UTSW 1 119765477 missense probably benign
R5471:Ptpn4 UTSW 1 119765919 nonsense probably null
R5826:Ptpn4 UTSW 1 119684516 missense probably benign 0.32
R5933:Ptpn4 UTSW 1 119687723 missense probably damaging 0.97
R6075:Ptpn4 UTSW 1 119765136 missense probably damaging 1.00
R6286:Ptpn4 UTSW 1 119721862 critical splice donor site probably null
R6389:Ptpn4 UTSW 1 119721954 missense probably damaging 0.97
R6392:Ptpn4 UTSW 1 119773123 missense probably benign
R6769:Ptpn4 UTSW 1 119715968 missense probably benign 0.01
R6794:Ptpn4 UTSW 1 119743390 missense probably damaging 1.00
R6933:Ptpn4 UTSW 1 119773148 intron probably benign
R6967:Ptpn4 UTSW 1 119684581 nonsense probably null
R6980:Ptpn4 UTSW 1 119743421 missense possibly damaging 0.86
R7150:Ptpn4 UTSW 1 119691745 critical splice donor site probably null
R7247:Ptpn4 UTSW 1 119690034 makesense probably null
R7283:Ptpn4 UTSW 1 119682531 missense possibly damaging 0.90
R7459:Ptpn4 UTSW 1 119659834 missense probably damaging 0.99
R7732:Ptpn4 UTSW 1 119692802 missense probably benign
R7794:Ptpn4 UTSW 1 119726037 missense probably damaging 1.00
R8061:Ptpn4 UTSW 1 119691600 critical splice donor site probably null
RF014:Ptpn4 UTSW 1 119684465 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAACTAGTTTCCATTTCATCGACAT -3'
(R):5'- TCTTACTCTGATGCTTATTGGGG -3'

Sequencing Primer
(F):5'- GGTGGCTCACAACCATCTGTAATG -3'
(R):5'- GTAGTTTCATGCTGTTTTCC -3'
Posted On2018-08-29