Incidental Mutation 'R6771:Rassf10'
ID532170
Institutional Source Beutler Lab
Gene Symbol Rassf10
Ensembl Gene ENSMUSG00000098132
Gene NameRas association (RalGDS/AF-6) domain family (N-terminal) member 10
Synonyms4632411J06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R6771 (G1)
Quality Score138.008
Status Validated
Chromosome7
Chromosomal Location112953962-112957457 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112954428 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 79 (M79V)
Ref Sequence ENSEMBL: ENSMUSP00000138103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182858]
Predicted Effect probably benign
Transcript: ENSMUST00000182858
AA Change: M79V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138103
Gene: ENSMUSG00000098132
AA Change: M79V

DomainStartEndE-ValueType
RA 2 133 2.25e-2 SMART
low complexity region 195 214 N/A INTRINSIC
coiled coil region 234 266 N/A INTRINSIC
coiled coil region 318 358 N/A INTRINSIC
coiled coil region 412 434 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.3%
Validation Efficiency 95% (37/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,461,461 H174Q probably damaging Het
Apoa4 G A 9: 46,243,167 M355I probably benign Het
Apol8 A T 15: 77,753,058 probably null Het
Arvcf A G 16: 18,403,864 T792A probably benign Het
Atp10b T C 11: 43,203,252 probably null Het
Atp9a A T 2: 168,674,900 Y340N probably damaging Het
C1rb T G 6: 124,577,405 S382A probably benign Het
Clmn A G 12: 104,773,782 V962A probably benign Het
Csmd1 A G 8: 16,071,394 V1763A possibly damaging Het
Ctnnd1 C A 2: 84,619,925 R317L probably damaging Het
Ctnnd1 A T 2: 84,620,110 D255E probably damaging Het
Cyb5a T A 18: 84,871,630 H61Q probably damaging Het
Dmxl2 A T 9: 54,416,524 I1192N probably damaging Het
Fam69b A G 2: 26,634,863 R92G probably benign Het
Flg T C 3: 93,288,323 probably benign Het
Fras1 A G 5: 96,598,941 I623M possibly damaging Het
Ftsj3 T C 11: 106,249,540 K801E probably damaging Het
Gpr35 T A 1: 92,982,704 M46K probably damaging Het
Ighv2-9 T G 12: 113,879,187 S87R probably damaging Het
Kdm4b C T 17: 56,351,754 A33V possibly damaging Het
Klhl5 T A 5: 65,164,652 Y534N probably damaging Het
March8 T C 6: 116,402,043 S313P probably benign Het
Mccc1 C T 3: 35,989,843 probably null Het
Memo1 A T 17: 74,201,278 F270L probably damaging Het
Nxpe3 C A 16: 55,866,108 G179V probably damaging Het
Olfr1477 T A 19: 13,502,954 F204I possibly damaging Het
Olfr726 C A 14: 50,083,989 A231S probably damaging Het
Olfr855 C T 9: 19,585,379 L281F probably benign Het
Otp A G 13: 94,875,786 D6G probably damaging Het
Ptpn4 T A 1: 119,715,968 N350I probably benign Het
Pwp2 G A 10: 78,182,388 probably null Het
Rbm12 A T 2: 156,097,455 I299N possibly damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Homo
Scfd2 T C 5: 74,531,456 H55R probably benign Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Sp110 C T 1: 85,592,279 probably null Het
Syde2 G A 3: 145,999,048 G318E probably damaging Het
Ttn T A 2: 76,708,539 D34649V possibly damaging Het
Other mutations in Rassf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0905:Rassf10 UTSW 7 112955368 missense probably damaging 1.00
R2903:Rassf10 UTSW 7 112954549 missense possibly damaging 0.94
R2904:Rassf10 UTSW 7 112954549 missense possibly damaging 0.94
R4559:Rassf10 UTSW 7 112955131 missense probably benign
R4796:Rassf10 UTSW 7 112954528 missense probably damaging 1.00
R5063:Rassf10 UTSW 7 112954424 missense probably benign
R5166:Rassf10 UTSW 7 112954420 missense probably benign 0.00
R6478:Rassf10 UTSW 7 112955707 missense probably damaging 1.00
R6642:Rassf10 UTSW 7 112955577 missense probably benign 0.00
R6769:Rassf10 UTSW 7 112954428 missense probably benign
R7161:Rassf10 UTSW 7 112954500 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATATCGGTGTGGATCTGCC -3'
(R):5'- TCCATACGTTCTACCGACGC -3'

Sequencing Primer
(F):5'- TCTGCCAGGAGGAGAAGCTG -3'
(R):5'- AAGGCCTTGCGTACCAC -3'
Posted On2018-08-29