Incidental Mutation 'R6771:Or7g35'
ID 532173
Institutional Source Beutler Lab
Gene Symbol Or7g35
Ensembl Gene ENSMUSG00000043087
Gene Name olfactory receptor family 7 subfamily G member 35
Synonyms Olfr855, MOR148-1, GA_x6K02T2PVTD-13330461-13331399
MMRRC Submission 044887-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R6771 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 19495807-19496798 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 19496675 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 281 (L281F)
Ref Sequence ENSEMBL: ENSMUSP00000150218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061693] [ENSMUST00000215587]
AlphaFold Q7TRF8
Predicted Effect probably benign
Transcript: ENSMUST00000061693
AA Change: L281F

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000054790
Gene: ENSMUSG00000043087
AA Change: L281F

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.7e-54 PFAM
Pfam:7TM_GPCR_Srsx 37 182 5.2e-8 PFAM
Pfam:7tm_1 43 292 2.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215587
AA Change: L281F

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.3%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,914,105 (GRCm39) H174Q probably damaging Het
Apoa4 G A 9: 46,154,465 (GRCm39) M355I probably benign Het
Apol8 A T 15: 77,637,258 (GRCm39) probably null Het
Arvcf A G 16: 18,222,614 (GRCm39) T792A probably benign Het
Atp10b T C 11: 43,094,079 (GRCm39) probably null Het
Atp9a A T 2: 168,516,820 (GRCm39) Y340N probably damaging Het
C1rb T G 6: 124,554,364 (GRCm39) S382A probably benign Het
Clmn A G 12: 104,740,041 (GRCm39) V962A probably benign Het
Csmd1 A G 8: 16,121,408 (GRCm39) V1763A possibly damaging Het
Ctnnd1 C A 2: 84,450,269 (GRCm39) R317L probably damaging Het
Ctnnd1 A T 2: 84,450,454 (GRCm39) D255E probably damaging Het
Cyb5a T A 18: 84,889,755 (GRCm39) H61Q probably damaging Het
Dipk1b A G 2: 26,524,875 (GRCm39) R92G probably benign Het
Dmxl2 A T 9: 54,323,808 (GRCm39) I1192N probably damaging Het
Flg T C 3: 93,195,630 (GRCm39) probably benign Het
Fras1 A G 5: 96,746,800 (GRCm39) I623M possibly damaging Het
Ftsj3 T C 11: 106,140,366 (GRCm39) K801E probably damaging Het
Gpr35 T A 1: 92,910,426 (GRCm39) M46K probably damaging Het
Ighv2-9 T G 12: 113,842,807 (GRCm39) S87R probably damaging Het
Kdm4b C T 17: 56,658,754 (GRCm39) A33V possibly damaging Het
Klhl5 T A 5: 65,321,995 (GRCm39) Y534N probably damaging Het
Marchf8 T C 6: 116,379,004 (GRCm39) S313P probably benign Het
Mccc1 C T 3: 36,043,992 (GRCm39) probably null Het
Memo1 A T 17: 74,508,273 (GRCm39) F270L probably damaging Het
Nxpe3 C A 16: 55,686,471 (GRCm39) G179V probably damaging Het
Or4k15c C A 14: 50,321,446 (GRCm39) A231S probably damaging Het
Or5b120 T A 19: 13,480,318 (GRCm39) F204I possibly damaging Het
Otp A G 13: 95,012,294 (GRCm39) D6G probably damaging Het
Ptpn4 T A 1: 119,643,698 (GRCm39) N350I probably benign Het
Pwp2 G A 10: 78,018,222 (GRCm39) probably null Het
Rassf10 A G 7: 112,553,635 (GRCm39) M79V probably benign Het
Rbm12 A T 2: 155,939,375 (GRCm39) I299N possibly damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,229,113 (GRCm39) probably benign Homo
Scfd2 T C 5: 74,692,117 (GRCm39) H55R probably benign Het
Skic2 G A 17: 35,064,166 (GRCm39) R507* probably null Het
Sp110 C T 1: 85,520,000 (GRCm39) probably null Het
Syde2 G A 3: 145,704,803 (GRCm39) G318E probably damaging Het
Ttn T A 2: 76,538,883 (GRCm39) D34649V possibly damaging Het
Other mutations in Or7g35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Or7g35 APN 9 19,496,616 (GRCm39) missense possibly damaging 0.74
IGL01405:Or7g35 APN 9 19,496,501 (GRCm39) missense probably benign 0.23
IGL01775:Or7g35 APN 9 19,496,001 (GRCm39) missense probably benign 0.04
IGL01920:Or7g35 APN 9 19,496,318 (GRCm39) missense probably benign 0.01
R0501:Or7g35 UTSW 9 19,495,914 (GRCm39) missense probably damaging 1.00
R0600:Or7g35 UTSW 9 19,496,600 (GRCm39) missense possibly damaging 0.47
R0667:Or7g35 UTSW 9 19,496,743 (GRCm39) missense probably benign
R1769:Or7g35 UTSW 9 19,496,682 (GRCm39) missense probably damaging 0.98
R3117:Or7g35 UTSW 9 19,496,237 (GRCm39) missense probably damaging 0.99
R4002:Or7g35 UTSW 9 19,496,010 (GRCm39) missense probably damaging 1.00
R4003:Or7g35 UTSW 9 19,496,010 (GRCm39) missense probably damaging 1.00
R4043:Or7g35 UTSW 9 19,496,291 (GRCm39) missense probably benign 0.16
R4243:Or7g35 UTSW 9 19,495,854 (GRCm39) missense probably damaging 1.00
R4672:Or7g35 UTSW 9 19,496,726 (GRCm39) missense possibly damaging 0.74
R4673:Or7g35 UTSW 9 19,496,726 (GRCm39) missense possibly damaging 0.74
R4959:Or7g35 UTSW 9 19,496,504 (GRCm39) missense probably benign
R4973:Or7g35 UTSW 9 19,496,504 (GRCm39) missense probably benign
R5223:Or7g35 UTSW 9 19,496,322 (GRCm39) missense probably benign 0.16
R5681:Or7g35 UTSW 9 19,496,195 (GRCm39) missense probably damaging 1.00
R6005:Or7g35 UTSW 9 19,496,181 (GRCm39) missense probably benign 0.45
R6017:Or7g35 UTSW 9 19,496,730 (GRCm39) missense probably benign 0.00
R6145:Or7g35 UTSW 9 19,496,184 (GRCm39) missense probably benign 0.02
R6615:Or7g35 UTSW 9 19,496,285 (GRCm39) missense probably benign 0.05
R6969:Or7g35 UTSW 9 19,495,886 (GRCm39) missense possibly damaging 0.77
R7239:Or7g35 UTSW 9 19,496,487 (GRCm39) missense probably damaging 1.00
R7313:Or7g35 UTSW 9 19,495,938 (GRCm39) missense probably damaging 1.00
R7361:Or7g35 UTSW 9 19,495,856 (GRCm39) missense probably benign 0.00
R8112:Or7g35 UTSW 9 19,496,020 (GRCm39) missense probably benign 0.44
R8470:Or7g35 UTSW 9 19,496,265 (GRCm39) missense probably damaging 0.99
R9155:Or7g35 UTSW 9 19,496,379 (GRCm39) missense probably benign 0.00
R9187:Or7g35 UTSW 9 19,495,950 (GRCm39) missense probably benign 0.03
R9422:Or7g35 UTSW 9 19,495,968 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGTGCTCTTTGTTGCAAC -3'
(R):5'- CGCATAGAGAGTCCAAGATTCAG -3'

Sequencing Primer
(F):5'- GTTCCTCTTTGTGGAATCATTTATTC -3'
(R):5'- CAAACTCTGAGCACAGTAC -3'
Posted On 2018-08-29