Incidental Mutation 'R6771:Olfr726'
ID532182
Institutional Source Beutler Lab
Gene Symbol Olfr726
Ensembl Gene ENSMUSG00000060523
Gene Nameolfactory receptor 726
SynonymsMOR246-4, GA_x6K02T2PMLR-5775299-5774334
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6771 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50083570-50090953 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 50083989 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 231 (A231S)
Ref Sequence ENSEMBL: ENSMUSP00000149373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072370] [ENSMUST00000206834] [ENSMUST00000213345] [ENSMUST00000215105] [ENSMUST00000215278] [ENSMUST00000217025] [ENSMUST00000217319] [ENSMUST00000217422]
Predicted Effect probably damaging
Transcript: ENSMUST00000072370
AA Change: A231S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072207
Gene: ENSMUSG00000060523
AA Change: A231S

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 1.3e-47 PFAM
Pfam:7TM_GPCR_Srsx 36 288 5.4e-8 PFAM
Pfam:7tm_1 41 287 7.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206834
AA Change: A231S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000213345
AA Change: A231S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215105
AA Change: A231S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215278
AA Change: A231S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217025
AA Change: A231S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217319
AA Change: A231S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217422
AA Change: A231S

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.3%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,461,461 H174Q probably damaging Het
Apoa4 G A 9: 46,243,167 M355I probably benign Het
Apol8 A T 15: 77,753,058 probably null Het
Arvcf A G 16: 18,403,864 T792A probably benign Het
Atp10b T C 11: 43,203,252 probably null Het
Atp9a A T 2: 168,674,900 Y340N probably damaging Het
C1rb T G 6: 124,577,405 S382A probably benign Het
Clmn A G 12: 104,773,782 V962A probably benign Het
Csmd1 A G 8: 16,071,394 V1763A possibly damaging Het
Ctnnd1 C A 2: 84,619,925 R317L probably damaging Het
Ctnnd1 A T 2: 84,620,110 D255E probably damaging Het
Cyb5a T A 18: 84,871,630 H61Q probably damaging Het
Dmxl2 A T 9: 54,416,524 I1192N probably damaging Het
Fam69b A G 2: 26,634,863 R92G probably benign Het
Flg T C 3: 93,288,323 probably benign Het
Fras1 A G 5: 96,598,941 I623M possibly damaging Het
Ftsj3 T C 11: 106,249,540 K801E probably damaging Het
Gpr35 T A 1: 92,982,704 M46K probably damaging Het
Ighv2-9 T G 12: 113,879,187 S87R probably damaging Het
Kdm4b C T 17: 56,351,754 A33V possibly damaging Het
Klhl5 T A 5: 65,164,652 Y534N probably damaging Het
March8 T C 6: 116,402,043 S313P probably benign Het
Mccc1 C T 3: 35,989,843 probably null Het
Memo1 A T 17: 74,201,278 F270L probably damaging Het
Nxpe3 C A 16: 55,866,108 G179V probably damaging Het
Olfr1477 T A 19: 13,502,954 F204I possibly damaging Het
Olfr855 C T 9: 19,585,379 L281F probably benign Het
Otp A G 13: 94,875,786 D6G probably damaging Het
Ptpn4 T A 1: 119,715,968 N350I probably benign Het
Pwp2 G A 10: 78,182,388 probably null Het
Rassf10 A G 7: 112,954,428 M79V probably benign Het
Rbm12 A T 2: 156,097,455 I299N possibly damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Homo
Scfd2 T C 5: 74,531,456 H55R probably benign Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Sp110 C T 1: 85,592,279 probably null Het
Syde2 G A 3: 145,999,048 G318E probably damaging Het
Ttn T A 2: 76,708,539 D34649V possibly damaging Het
Other mutations in Olfr726
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Olfr726 APN 14 50083997 missense probably benign 0.00
IGL01432:Olfr726 APN 14 50083947 missense probably benign 0.07
IGL01788:Olfr726 APN 14 50084502 missense probably damaging 1.00
IGL01957:Olfr726 APN 14 50084280 missense probably benign 0.00
IGL02132:Olfr726 APN 14 50084486 missense probably damaging 1.00
R0611:Olfr726 UTSW 14 50083853 missense probably damaging 1.00
R0689:Olfr726 UTSW 14 50084232 missense probably benign 0.01
R1556:Olfr726 UTSW 14 50084459 missense possibly damaging 0.90
R1710:Olfr726 UTSW 14 50084370 missense probably benign 0.01
R1791:Olfr726 UTSW 14 50084042 missense probably benign 0.03
R1804:Olfr726 UTSW 14 50083902 missense probably damaging 0.99
R1853:Olfr726 UTSW 14 50084120 missense probably damaging 1.00
R2034:Olfr726 UTSW 14 50083983 missense probably benign 0.34
R3155:Olfr726 UTSW 14 50084525 missense probably benign 0.09
R3156:Olfr726 UTSW 14 50084525 missense probably benign 0.09
R3939:Olfr726 UTSW 14 50083716 makesense probably null
R4392:Olfr726 UTSW 14 50084603 missense probably benign 0.24
R4533:Olfr726 UTSW 14 50083699 unclassified probably null
R4694:Olfr726 UTSW 14 50084019 missense probably benign
R5183:Olfr726 UTSW 14 50084546 missense probably damaging 0.99
R5859:Olfr726 UTSW 14 50084027 missense probably damaging 1.00
R6186:Olfr726 UTSW 14 50084525 missense probably damaging 0.98
R6357:Olfr726 UTSW 14 50083989 missense probably damaging 0.99
R6834:Olfr726 UTSW 14 50084228 missense probably damaging 0.99
R6924:Olfr726 UTSW 14 50083850 missense possibly damaging 0.91
R8043:Olfr726 UTSW 14 50083910 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GCTTTGACATAGCTGCTTTCAC -3'
(R):5'- GGCATTCACTGTTAACTTGCC -3'

Sequencing Primer
(F):5'- ACCTCTTTGTTTCTCAGAGTGTAG -3'
(R):5'- GGTCCTAACCAGGTGGACAG -3'
Posted On2018-08-29