Incidental Mutation 'R6771:Nxpe3'
ID532184
Institutional Source Beutler Lab
Gene Symbol Nxpe3
Ensembl Gene ENSMUSG00000075033
Gene Nameneurexophilin and PC-esterase domain family, member 3
SynonymsFam55c, LOC208684, LOC385658
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6771 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location55839953-55895285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 55866108 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 179 (G179V)
Ref Sequence ENSEMBL: ENSMUSP00000097296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099705]
Predicted Effect probably damaging
Transcript: ENSMUST00000099705
AA Change: G179V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097296
Gene: ENSMUSG00000075033
AA Change: G179V

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Neurexophilin 73 284 2.9e-64 PFAM
Meta Mutation Damage Score 0.9627 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.3%
Validation Efficiency 95% (37/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexophilin family of neuropeptide-like glycoproteins. The encoded protein contains a variable N-terminal domain, a highly conserved neurexophilin and PC-esterase (NXPE) central domain, a short linker region, and a cysteine-rich C-terminal domain. This protein binds alpha neurexins, a group of presynaptic transmembrane receptors that promote adhesion between dendrites and axons. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 G T 8: 71,461,461 H174Q probably damaging Het
Apoa4 G A 9: 46,243,167 M355I probably benign Het
Apol8 A T 15: 77,753,058 probably null Het
Arvcf A G 16: 18,403,864 T792A probably benign Het
Atp10b T C 11: 43,203,252 probably null Het
Atp9a A T 2: 168,674,900 Y340N probably damaging Het
C1rb T G 6: 124,577,405 S382A probably benign Het
Clmn A G 12: 104,773,782 V962A probably benign Het
Csmd1 A G 8: 16,071,394 V1763A possibly damaging Het
Ctnnd1 C A 2: 84,619,925 R317L probably damaging Het
Ctnnd1 A T 2: 84,620,110 D255E probably damaging Het
Cyb5a T A 18: 84,871,630 H61Q probably damaging Het
Dmxl2 A T 9: 54,416,524 I1192N probably damaging Het
Fam69b A G 2: 26,634,863 R92G probably benign Het
Flg T C 3: 93,288,323 probably benign Het
Fras1 A G 5: 96,598,941 I623M possibly damaging Het
Ftsj3 T C 11: 106,249,540 K801E probably damaging Het
Gpr35 T A 1: 92,982,704 M46K probably damaging Het
Ighv2-9 T G 12: 113,879,187 S87R probably damaging Het
Kdm4b C T 17: 56,351,754 A33V possibly damaging Het
Klhl5 T A 5: 65,164,652 Y534N probably damaging Het
March8 T C 6: 116,402,043 S313P probably benign Het
Mccc1 C T 3: 35,989,843 probably null Het
Memo1 A T 17: 74,201,278 F270L probably damaging Het
Olfr1477 T A 19: 13,502,954 F204I possibly damaging Het
Olfr726 C A 14: 50,083,989 A231S probably damaging Het
Olfr855 C T 9: 19,585,379 L281F probably benign Het
Otp A G 13: 94,875,786 D6G probably damaging Het
Ptpn4 T A 1: 119,715,968 N350I probably benign Het
Pwp2 G A 10: 78,182,388 probably null Het
Rassf10 A G 7: 112,954,428 M79V probably benign Het
Rbm12 A T 2: 156,097,455 I299N possibly damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Homo
Scfd2 T C 5: 74,531,456 H55R probably benign Het
Skiv2l G A 17: 34,845,190 R507* probably null Het
Sp110 C T 1: 85,592,279 probably null Het
Syde2 G A 3: 145,999,048 G318E probably damaging Het
Ttn T A 2: 76,708,539 D34649V possibly damaging Het
Other mutations in Nxpe3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Nxpe3 APN 16 55844232 missense probably damaging 0.98
IGL01743:Nxpe3 APN 16 55849765 missense probably benign 0.00
IGL02355:Nxpe3 APN 16 55890586 missense probably benign 0.11
IGL02362:Nxpe3 APN 16 55890586 missense probably benign 0.11
IGL02750:Nxpe3 APN 16 55860375 missense probably benign 0.21
IGL02792:Nxpe3 APN 16 55866172 missense probably damaging 0.98
IGL03383:Nxpe3 APN 16 55849713 missense probably benign 0.00
R0126:Nxpe3 UTSW 16 55866229 missense possibly damaging 0.94
R0348:Nxpe3 UTSW 16 55866535 missense probably benign 0.01
R0526:Nxpe3 UTSW 16 55866517 missense possibly damaging 0.86
R1752:Nxpe3 UTSW 16 55866474 missense probably benign
R1830:Nxpe3 UTSW 16 55866081 missense probably damaging 1.00
R2285:Nxpe3 UTSW 16 55866225 missense probably damaging 1.00
R3196:Nxpe3 UTSW 16 55849715 missense probably damaging 0.99
R4863:Nxpe3 UTSW 16 55849633 missense probably damaging 1.00
R4922:Nxpe3 UTSW 16 55860324 missense probably benign
R5308:Nxpe3 UTSW 16 55866471 missense probably benign 0.43
R5338:Nxpe3 UTSW 16 55866343 missense possibly damaging 0.52
R5539:Nxpe3 UTSW 16 55890671 missense possibly damaging 0.92
R5780:Nxpe3 UTSW 16 55866441 missense probably damaging 1.00
R5877:Nxpe3 UTSW 16 55866201 missense probably damaging 1.00
R6769:Nxpe3 UTSW 16 55866108 missense probably damaging 1.00
R6841:Nxpe3 UTSW 16 55844322 missense possibly damaging 0.65
R7660:Nxpe3 UTSW 16 55844327 missense probably damaging 0.96
Z1177:Nxpe3 UTSW 16 55866222 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGATCCGTAAAGTTGCACAAG -3'
(R):5'- TCGTCATCTTGAACTCTGCAAC -3'

Sequencing Primer
(F):5'- CGTAAAGTTGCACAAGGGAAGACTTC -3'
(R):5'- AACCTTCTTCAGGGTGGGGAG -3'
Posted On2018-08-29