Incidental Mutation 'R6772:Ifi206'
ID532191
Institutional Source Beutler Lab
Gene Symbol Ifi206
Ensembl Gene ENSMUSG00000037849
Gene Nameinterferon activated gene 206
SynonymsGm4955, Pyblhin-C
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R6772 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location173468485-173491041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 173481207 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 408 (M408V)
Ref Sequence ENSEMBL: ENSMUSP00000134646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160565]
Predicted Effect unknown
Transcript: ENSMUST00000160565
AA Change: M408V
SMART Domains Protein: ENSMUSP00000134646
Gene: ENSMUSG00000037849
AA Change: M408V

DomainStartEndE-ValueType
PYRIN 6 84 5.7e-21 SMART
low complexity region 97 108 N/A INTRINSIC
internal_repeat_1 154 349 6.25e-15 PROSPERO
internal_repeat_1 342 575 6.25e-15 PROSPERO
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,053 D1144V probably damaging Het
Ankrd13a A G 5: 114,801,743 H477R probably benign Het
Anxa3 A T 5: 96,811,113 I27F probably damaging Het
Aplf T C 6: 87,663,799 E76G possibly damaging Het
Bbs1 A G 19: 4,906,590 probably benign Het
Camk2a T C 18: 60,969,020 S332P probably benign Het
Casz1 T A 4: 148,943,206 F1013L probably damaging Het
Cd109 A T 9: 78,680,810 I707F possibly damaging Het
Cd4 G A 6: 124,872,458 T202I probably benign Het
Celsr1 A G 15: 86,030,782 S997P probably benign Het
Cfap77 T C 2: 29,054,939 T24A probably damaging Het
Dscaml1 G A 9: 45,710,311 R1019H probably damaging Het
Epb41l4b C A 4: 57,063,140 V517F probably benign Het
Exosc10 G A 4: 148,581,134 D818N probably damaging Het
Furin C T 7: 80,393,492 G324S probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Kdm4a T C 4: 118,142,555 probably null Het
Neo1 T A 9: 58,902,976 Q1064L probably damaging Het
Nphp4 G A 4: 152,544,406 V750I probably benign Het
Pcdhac1 T C 18: 37,090,236 V34A probably benign Het
Pdk4 T C 6: 5,487,141 I302V probably benign Het
Prl6a1 A G 13: 27,319,048 D209G probably damaging Het
Pspn T C 17: 56,999,515 Q138R probably benign Het
Ptgs2 A G 1: 150,102,078 Y134C probably damaging Het
Rlbp1 G A 7: 79,384,050 probably benign Het
Rpia T C 6: 70,785,548 I108V probably benign Het
Tcaf1 A T 6: 42,675,276 H757Q probably damaging Het
Ttc8 A C 12: 98,943,589 S143R probably damaging Het
Uba6 A G 5: 86,147,073 probably null Het
Ubr4 A T 4: 139,467,230 K4280* probably null Het
Vmn2r15 C A 5: 109,286,372 S822I probably damaging Het
Vps53 A T 11: 76,179,498 M1K probably null Het
Zfp362 A G 4: 128,790,260 M18T possibly damaging Het
Zfp429 A G 13: 67,390,198 C376R probably damaging Het
Zfyve9 T C 4: 108,639,269 N1395S probably damaging Het
Zmynd8 T A 2: 165,807,601 Q857H probably benign Het
Other mutations in Ifi206
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01509:Ifi206 APN 1 173485576 missense probably benign 0.00
IGL02044:Ifi206 APN 1 173480991 missense probably benign 0.41
IGL02118:Ifi206 APN 1 173481768 missense probably benign 0.05
IGL02476:Ifi206 APN 1 173481566 missense probably benign 0.02
IGL02824:Ifi206 APN 1 173481872 missense possibly damaging 0.95
IGL03375:Ifi206 APN 1 173480778 missense probably benign 0.06
PIT4142001:Ifi206 UTSW 1 173481164 missense probably benign 0.02
R0069:Ifi206 UTSW 1 173486847 missense probably damaging 1.00
R0741:Ifi206 UTSW 1 173473749 missense probably benign 0.41
R1572:Ifi206 UTSW 1 173486853 missense probably benign 0.10
R1742:Ifi206 UTSW 1 173481971 missense probably benign 0.06
R4109:Ifi206 UTSW 1 173480988 missense probably benign 0.00
R4707:Ifi206 UTSW 1 173480866 missense probably benign 0.00
R4783:Ifi206 UTSW 1 173480866 missense probably benign 0.00
R4785:Ifi206 UTSW 1 173480866 missense probably benign 0.00
R4805:Ifi206 UTSW 1 173481386 missense possibly damaging 0.55
R4918:Ifi206 UTSW 1 173482044 missense possibly damaging 0.73
R5043:Ifi206 UTSW 1 173486718 missense probably damaging 1.00
R5080:Ifi206 UTSW 1 173473848 missense possibly damaging 0.61
R5419:Ifi206 UTSW 1 173481231 missense probably benign 0.05
R5420:Ifi206 UTSW 1 173481033 missense possibly damaging 0.84
R5777:Ifi206 UTSW 1 173481362 missense possibly damaging 0.55
R5988:Ifi206 UTSW 1 173481340 missense possibly damaging 0.90
R6782:Ifi206 UTSW 1 173481357 missense unknown
R6806:Ifi206 UTSW 1 173481571 missense probably benign 0.06
R7042:Ifi206 UTSW 1 173481242 missense
R7091:Ifi206 UTSW 1 173473875 missense unknown
R7292:Ifi206 UTSW 1 173473862 missense unknown
R7429:Ifi206 UTSW 1 173480591 missense
R7499:Ifi206 UTSW 1 173482041 missense
R7772:Ifi206 UTSW 1 173481074 missense
X0052:Ifi206 UTSW 1 173481969 missense possibly damaging 0.89
Z1088:Ifi206 UTSW 1 173474011 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGCTGCAGAGATCTGAG -3'
(R):5'- GGTGACTCCAGTAACAGTGG -3'

Sequencing Primer
(F):5'- TCTGAGGACTATTACAGCCATGG -3'
(R):5'- TCCAGTAACAGTGGCCAGCAG -3'
Posted On2018-08-29