Incidental Mutation 'R6772:Cfap77'
ID532192
Institutional Source Beutler Lab
Gene Symbol Cfap77
Ensembl Gene ENSMUSG00000079502
Gene Namecilia and flagella associated protein 77
SynonymsLOC329375, 1700101E01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R6772 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location28926949-29055066 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29054939 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 24 (T24A)
Ref Sequence ENSEMBL: ENSMUSP00000140084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000157048] [ENSMUST00000189027] [ENSMUST00000189711]
Predicted Effect probably benign
Transcript: ENSMUST00000157048
AA Change: T24A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000125742
Gene: ENSMUSG00000079502
AA Change: T24A

DomainStartEndE-ValueType
Pfam:DUF4483 54 204 1.1e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189027
AA Change: T24A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000189711
AA Change: T24A

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140645
Gene: ENSMUSG00000079502
AA Change: T24A

DomainStartEndE-ValueType
Pfam:DUF4483 52 250 9.4e-65 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,053 D1144V probably damaging Het
Ankrd13a A G 5: 114,801,743 H477R probably benign Het
Anxa3 A T 5: 96,811,113 I27F probably damaging Het
Aplf T C 6: 87,663,799 E76G possibly damaging Het
Bbs1 A G 19: 4,906,590 probably benign Het
Camk2a T C 18: 60,969,020 S332P probably benign Het
Casz1 T A 4: 148,943,206 F1013L probably damaging Het
Cd109 A T 9: 78,680,810 I707F possibly damaging Het
Cd4 G A 6: 124,872,458 T202I probably benign Het
Celsr1 A G 15: 86,030,782 S997P probably benign Het
Dscaml1 G A 9: 45,710,311 R1019H probably damaging Het
Epb41l4b C A 4: 57,063,140 V517F probably benign Het
Exosc10 G A 4: 148,581,134 D818N probably damaging Het
Furin C T 7: 80,393,492 G324S probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifi206 T C 1: 173,481,207 M408V unknown Het
Kdm4a T C 4: 118,142,555 probably null Het
Neo1 T A 9: 58,902,976 Q1064L probably damaging Het
Nphp4 G A 4: 152,544,406 V750I probably benign Het
Pcdhac1 T C 18: 37,090,236 V34A probably benign Het
Pdk4 T C 6: 5,487,141 I302V probably benign Het
Prl6a1 A G 13: 27,319,048 D209G probably damaging Het
Pspn T C 17: 56,999,515 Q138R probably benign Het
Ptgs2 A G 1: 150,102,078 Y134C probably damaging Het
Rlbp1 G A 7: 79,384,050 probably benign Het
Rpia T C 6: 70,785,548 I108V probably benign Het
Tcaf1 A T 6: 42,675,276 H757Q probably damaging Het
Ttc8 A C 12: 98,943,589 S143R probably damaging Het
Uba6 A G 5: 86,147,073 probably null Het
Ubr4 A T 4: 139,467,230 K4280* probably null Het
Vmn2r15 C A 5: 109,286,372 S822I probably damaging Het
Vps53 A T 11: 76,179,498 M1K probably null Het
Zfp362 A G 4: 128,790,260 M18T possibly damaging Het
Zfp429 A G 13: 67,390,198 C376R probably damaging Het
Zfyve9 T C 4: 108,639,269 N1395S probably damaging Het
Zmynd8 T A 2: 165,807,601 Q857H probably benign Het
Other mutations in Cfap77
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02427:Cfap77 APN 2 28955580 nonsense probably null
R0094:Cfap77 UTSW 2 28984434 missense probably damaging 1.00
R1164:Cfap77 UTSW 2 28962688 missense probably damaging 1.00
R3081:Cfap77 UTSW 2 28962650 missense probably damaging 1.00
R4732:Cfap77 UTSW 2 28984388 missense probably benign 0.17
R4733:Cfap77 UTSW 2 28984388 missense probably benign 0.17
R4831:Cfap77 UTSW 2 28985832 missense probably benign 0.00
R7170:Cfap77 UTSW 2 28985842 nonsense probably null
R7466:Cfap77 UTSW 2 28955613 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCAGCAGCTGGAACCCATC -3'
(R):5'- TAAGCTTTGGACAGAGGCTC -3'

Sequencing Primer
(F):5'- AACCCATCGGCGGCGTC -3'
(R):5'- TTTGGACAGAGGCTCCGCAG -3'
Posted On2018-08-29