Incidental Mutation 'R6772:Epb41l4b'
ID532194
Institutional Source Beutler Lab
Gene Symbol Epb41l4b
Ensembl Gene ENSMUSG00000028434
Gene Nameerythrocyte membrane protein band 4.1 like 4b
Synonyms6430543G08Rik, D4Ertd346e, Lulu2, Epb4.1l4b, Ehm2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6772 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location56991972-57143437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 57063140 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 517 (V517F)
Ref Sequence ENSEMBL: ENSMUSP00000030142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030142] [ENSMUST00000095076]
Predicted Effect probably benign
Transcript: ENSMUST00000030142
AA Change: V517F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030142
Gene: ENSMUSG00000028434
AA Change: V517F

DomainStartEndE-ValueType
low complexity region 18 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
B41 81 277 4.09e-69 SMART
FERM_C 281 373 1.76e-35 SMART
FA 378 422 2.86e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095076
SMART Domains Protein: ENSMUSP00000092687
Gene: ENSMUSG00000028434

DomainStartEndE-ValueType
low complexity region 18 57 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
B41 81 277 4.09e-69 SMART
FERM_C 281 373 1.76e-35 SMART
FA 378 422 2.86e-12 SMART
low complexity region 504 513 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,053 D1144V probably damaging Het
Ankrd13a A G 5: 114,801,743 H477R probably benign Het
Anxa3 A T 5: 96,811,113 I27F probably damaging Het
Aplf T C 6: 87,663,799 E76G possibly damaging Het
Bbs1 A G 19: 4,906,590 probably benign Het
Camk2a T C 18: 60,969,020 S332P probably benign Het
Casz1 T A 4: 148,943,206 F1013L probably damaging Het
Cd109 A T 9: 78,680,810 I707F possibly damaging Het
Cd4 G A 6: 124,872,458 T202I probably benign Het
Celsr1 A G 15: 86,030,782 S997P probably benign Het
Cfap77 T C 2: 29,054,939 T24A probably damaging Het
Dscaml1 G A 9: 45,710,311 R1019H probably damaging Het
Exosc10 G A 4: 148,581,134 D818N probably damaging Het
Furin C T 7: 80,393,492 G324S probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifi206 T C 1: 173,481,207 M408V unknown Het
Kdm4a T C 4: 118,142,555 probably null Het
Neo1 T A 9: 58,902,976 Q1064L probably damaging Het
Nphp4 G A 4: 152,544,406 V750I probably benign Het
Pcdhac1 T C 18: 37,090,236 V34A probably benign Het
Pdk4 T C 6: 5,487,141 I302V probably benign Het
Prl6a1 A G 13: 27,319,048 D209G probably damaging Het
Pspn T C 17: 56,999,515 Q138R probably benign Het
Ptgs2 A G 1: 150,102,078 Y134C probably damaging Het
Rlbp1 G A 7: 79,384,050 probably benign Het
Rpia T C 6: 70,785,548 I108V probably benign Het
Tcaf1 A T 6: 42,675,276 H757Q probably damaging Het
Ttc8 A C 12: 98,943,589 S143R probably damaging Het
Uba6 A G 5: 86,147,073 probably null Het
Ubr4 A T 4: 139,467,230 K4280* probably null Het
Vmn2r15 C A 5: 109,286,372 S822I probably damaging Het
Vps53 A T 11: 76,179,498 M1K probably null Het
Zfp362 A G 4: 128,790,260 M18T possibly damaging Het
Zfp429 A G 13: 67,390,198 C376R probably damaging Het
Zfyve9 T C 4: 108,639,269 N1395S probably damaging Het
Zmynd8 T A 2: 165,807,601 Q857H probably benign Het
Other mutations in Epb41l4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Epb41l4b APN 4 57103422 critical splice donor site probably null
IGL02311:Epb41l4b APN 4 57076456 missense probably damaging 1.00
Episode UTSW 4 57142866 missense probably benign 0.00
R0456:Epb41l4b UTSW 4 57142843 splice site probably null
R0799:Epb41l4b UTSW 4 57086003 missense probably damaging 1.00
R0905:Epb41l4b UTSW 4 57103528 missense probably damaging 1.00
R1208:Epb41l4b UTSW 4 57077252 critical splice acceptor site probably null
R1208:Epb41l4b UTSW 4 57077252 critical splice acceptor site probably null
R1506:Epb41l4b UTSW 4 57088824 missense probably damaging 1.00
R1618:Epb41l4b UTSW 4 57032204 missense probably benign 0.00
R1919:Epb41l4b UTSW 4 57040993 missense probably damaging 0.99
R1956:Epb41l4b UTSW 4 57038553 missense possibly damaging 0.94
R2041:Epb41l4b UTSW 4 57084070 missense probably damaging 0.98
R2048:Epb41l4b UTSW 4 57142866 missense probably benign 0.00
R3434:Epb41l4b UTSW 4 57040865 missense probably benign 0.41
R4059:Epb41l4b UTSW 4 57024337 critical splice donor site probably null
R4175:Epb41l4b UTSW 4 57076556 missense probably damaging 1.00
R4694:Epb41l4b UTSW 4 57019875 missense probably benign 0.01
R4817:Epb41l4b UTSW 4 57103428 missense probably damaging 1.00
R5076:Epb41l4b UTSW 4 57040984 missense probably damaging 1.00
R5179:Epb41l4b UTSW 4 57063181 missense probably benign 0.01
R5246:Epb41l4b UTSW 4 57040989 missense probably damaging 0.99
R5530:Epb41l4b UTSW 4 57086003 missense probably damaging 1.00
R5579:Epb41l4b UTSW 4 57064802 missense possibly damaging 0.62
R5784:Epb41l4b UTSW 4 57086003 missense probably damaging 1.00
R6965:Epb41l4b UTSW 4 57040915 missense probably damaging 1.00
R7045:Epb41l4b UTSW 4 57103522 missense possibly damaging 0.94
R7316:Epb41l4b UTSW 4 57019867 missense probably benign 0.01
R7750:Epb41l4b UTSW 4 57076913 critical splice donor site probably null
Z1177:Epb41l4b UTSW 4 57063191 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAAACGATTCCTGAGCCTTTAGC -3'
(R):5'- TGACCACGCTCATTTCTGAATTG -3'

Sequencing Primer
(F):5'- TGCATTCCACAGTAAATCATGGC -3'
(R):5'- GAATTGTCTTCCATTCTCCCAGTAAC -3'
Posted On2018-08-29