Incidental Mutation 'R6772:Zfyve9'
ID532195
Institutional Source Beutler Lab
Gene Symbol Zfyve9
Ensembl Gene ENSMUSG00000034557
Gene Namezinc finger, FYVE domain containing 9
SynonymsMadhip
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.476) question?
Stock #R6772 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location108637466-108780798 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108639269 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1395 (N1395S)
Ref Sequence ENSEMBL: ENSMUSP00000102268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042185] [ENSMUST00000106657] [ENSMUST00000106658]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042185
AA Change: N704S

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039852
Gene: ENSMUSG00000034557
AA Change: N704S

DomainStartEndE-ValueType
Blast:FYVE 7 40 4e-7 BLAST
Pfam:SARA 52 92 1e-25 PFAM
Pfam:DUF3480 328 681 1.4e-189 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106657
AA Change: N1395S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102268
Gene: ENSMUSG00000034557
AA Change: N1395S

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 7e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:SARA 745 783 1.3e-22 PFAM
Pfam:DUF3480 1020 1372 1e-178 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106658
AA Change: N1336S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102269
Gene: ENSMUSG00000034557
AA Change: N1336S

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 8e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:DUF3480 960 1313 5.5e-189 PFAM
Meta Mutation Damage Score 0.1103 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a double zinc finger motif-containing protein that participates in the transforming growth factor-beta (TGFB) signalling pathway. The encoded protein interacts directly with SMAD2 and SMAD3, and recruits SMAD2 to the TGFB receptor. There are multiple pseudogenes for this gene on chromosomes 2, 15, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,053 D1144V probably damaging Het
Ankrd13a A G 5: 114,801,743 H477R probably benign Het
Anxa3 A T 5: 96,811,113 I27F probably damaging Het
Aplf T C 6: 87,663,799 E76G possibly damaging Het
Bbs1 A G 19: 4,906,590 probably benign Het
Camk2a T C 18: 60,969,020 S332P probably benign Het
Casz1 T A 4: 148,943,206 F1013L probably damaging Het
Cd109 A T 9: 78,680,810 I707F possibly damaging Het
Cd4 G A 6: 124,872,458 T202I probably benign Het
Celsr1 A G 15: 86,030,782 S997P probably benign Het
Cfap77 T C 2: 29,054,939 T24A probably damaging Het
Dscaml1 G A 9: 45,710,311 R1019H probably damaging Het
Epb41l4b C A 4: 57,063,140 V517F probably benign Het
Exosc10 G A 4: 148,581,134 D818N probably damaging Het
Furin C T 7: 80,393,492 G324S probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifi206 T C 1: 173,481,207 M408V unknown Het
Kdm4a T C 4: 118,142,555 probably null Het
Neo1 T A 9: 58,902,976 Q1064L probably damaging Het
Nphp4 G A 4: 152,544,406 V750I probably benign Het
Pcdhac1 T C 18: 37,090,236 V34A probably benign Het
Pdk4 T C 6: 5,487,141 I302V probably benign Het
Prl6a1 A G 13: 27,319,048 D209G probably damaging Het
Pspn T C 17: 56,999,515 Q138R probably benign Het
Ptgs2 A G 1: 150,102,078 Y134C probably damaging Het
Rlbp1 G A 7: 79,384,050 probably benign Het
Rpia T C 6: 70,785,548 I108V probably benign Het
Tcaf1 A T 6: 42,675,276 H757Q probably damaging Het
Ttc8 A C 12: 98,943,589 S143R probably damaging Het
Uba6 A G 5: 86,147,073 probably benign Het
Ubr4 A T 4: 139,467,230 K4280* probably null Het
Vmn2r15 C A 5: 109,286,372 S822I probably damaging Het
Vps53 A T 11: 76,179,498 M1K probably null Het
Zfp362 A G 4: 128,790,260 M18T possibly damaging Het
Zfp429 A G 13: 67,390,198 C376R probably damaging Het
Zmynd8 T A 2: 165,807,601 Q857H probably benign Het
Other mutations in Zfyve9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Zfyve9 APN 4 108642107 missense possibly damaging 0.85
IGL01161:Zfyve9 APN 4 108681064 missense probably damaging 1.00
IGL01404:Zfyve9 APN 4 108682151 missense probably damaging 1.00
IGL01451:Zfyve9 APN 4 108682260 missense probably damaging 0.98
IGL01655:Zfyve9 APN 4 108642092 missense probably damaging 1.00
IGL02567:Zfyve9 APN 4 108674523 missense probably damaging 1.00
IGL02593:Zfyve9 APN 4 108682223 missense possibly damaging 0.73
IGL03169:Zfyve9 APN 4 108695825 missense probably damaging 1.00
IGL03206:Zfyve9 APN 4 108689209 missense possibly damaging 0.88
IGL03288:Zfyve9 APN 4 108723799 splice site probably benign
R0008:Zfyve9 UTSW 4 108718705 missense possibly damaging 0.92
R0008:Zfyve9 UTSW 4 108718705 missense possibly damaging 0.92
R0104:Zfyve9 UTSW 4 108718163 missense probably damaging 1.00
R0104:Zfyve9 UTSW 4 108718163 missense probably damaging 1.00
R0362:Zfyve9 UTSW 4 108680969 missense probably damaging 0.96
R0502:Zfyve9 UTSW 4 108719764 nonsense probably null
R0503:Zfyve9 UTSW 4 108719764 nonsense probably null
R0557:Zfyve9 UTSW 4 108674511 missense probably damaging 0.98
R0835:Zfyve9 UTSW 4 108718669 missense probably damaging 0.99
R1215:Zfyve9 UTSW 4 108650229 missense probably benign 0.32
R1245:Zfyve9 UTSW 4 108693311 intron probably benign
R1527:Zfyve9 UTSW 4 108695767 critical splice donor site probably null
R1638:Zfyve9 UTSW 4 108684907 critical splice donor site probably null
R1653:Zfyve9 UTSW 4 108660577 nonsense probably null
R1728:Zfyve9 UTSW 4 108718501 missense possibly damaging 0.80
R1729:Zfyve9 UTSW 4 108718501 missense possibly damaging 0.80
R1861:Zfyve9 UTSW 4 108682295 splice site probably benign
R1983:Zfyve9 UTSW 4 108689189 missense possibly damaging 0.94
R2050:Zfyve9 UTSW 4 108718603 missense probably benign 0.05
R2050:Zfyve9 UTSW 4 108719303 missense possibly damaging 0.94
R2246:Zfyve9 UTSW 4 108689264 missense possibly damaging 0.70
R2338:Zfyve9 UTSW 4 108660614 missense probably damaging 1.00
R2697:Zfyve9 UTSW 4 108695819 missense probably damaging 0.99
R3522:Zfyve9 UTSW 4 108719743 missense probably benign 0.45
R4030:Zfyve9 UTSW 4 108719701 missense possibly damaging 0.61
R4247:Zfyve9 UTSW 4 108719192 missense probably benign 0.28
R4273:Zfyve9 UTSW 4 108680976 missense probably damaging 1.00
R4720:Zfyve9 UTSW 4 108644368 missense possibly damaging 0.94
R4835:Zfyve9 UTSW 4 108717998 missense possibly damaging 0.70
R4871:Zfyve9 UTSW 4 108680986 missense probably damaging 1.00
R4881:Zfyve9 UTSW 4 108727491 splice site probably null
R4974:Zfyve9 UTSW 4 108680900 critical splice donor site probably null
R5024:Zfyve9 UTSW 4 108691669 missense probably benign 0.18
R5481:Zfyve9 UTSW 4 108644349 missense probably damaging 1.00
R5660:Zfyve9 UTSW 4 108719168 missense probably benign
R5965:Zfyve9 UTSW 4 108691681 missense possibly damaging 0.53
R5996:Zfyve9 UTSW 4 108719360 missense probably benign 0.07
R6315:Zfyve9 UTSW 4 108674488 missense probably damaging 1.00
R6865:Zfyve9 UTSW 4 108644361 missense possibly damaging 0.71
R7112:Zfyve9 UTSW 4 108650322 missense probably benign 0.00
R7258:Zfyve9 UTSW 4 108656954 missense possibly damaging 0.94
R7266:Zfyve9 UTSW 4 108718547 missense possibly damaging 0.62
R7287:Zfyve9 UTSW 4 108718256 missense probably benign 0.00
R7356:Zfyve9 UTSW 4 108719015 missense probably benign 0.01
R7389:Zfyve9 UTSW 4 108693318 critical splice donor site probably null
R7729:Zfyve9 UTSW 4 108691776 missense probably benign 0.01
R7780:Zfyve9 UTSW 4 108719101 missense possibly damaging 0.81
R7801:Zfyve9 UTSW 4 108684995 missense possibly damaging 0.50
R8069:Zfyve9 UTSW 4 108685018 missense probably benign 0.32
R8201:Zfyve9 UTSW 4 108650277 missense possibly damaging 0.83
R8221:Zfyve9 UTSW 4 108719680 missense possibly damaging 0.77
R8682:Zfyve9 UTSW 4 108719342 missense probably benign 0.30
Z1176:Zfyve9 UTSW 4 108642207 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGGAACATCTGTCCCCTACCAC -3'
(R):5'- TGTTGGGCTCATGGCAAAGG -3'

Sequencing Primer
(F):5'- ATCTGTCCCCTACCACCCTCC -3'
(R):5'- GTTCAGCCCTCTGCAGAGATC -3'
Posted On2018-08-29