Incidental Mutation 'R6772:Ankrd13a'
ID532205
Institutional Source Beutler Lab
Gene Symbol Ankrd13a
Ensembl Gene ENSMUSG00000041870
Gene Nameankyrin repeat domain 13a
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R6772 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location114774677-114806200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114801743 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 477 (H477R)
Ref Sequence ENSEMBL: ENSMUSP00000099638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102578]
Predicted Effect probably benign
Transcript: ENSMUST00000102578
AA Change: H477R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000099638
Gene: ENSMUSG00000041870
AA Change: H477R

DomainStartEndE-ValueType
ANK 40 69 1.51e-4 SMART
ANK 73 104 2.03e-1 SMART
Pfam:GPCR_chapero_1 156 468 5.5e-107 PFAM
UIM 480 500 2.98e2 SMART
UIM 517 536 2.01e1 SMART
UIM 547 566 5.33e1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000137519
AA Change: H411R
SMART Domains Protein: ENSMUSP00000116994
Gene: ENSMUSG00000041870
AA Change: H411R

DomainStartEndE-ValueType
ANK 7 38 2.03e-1 SMART
Pfam:GPCR_chapero_1 90 403 8.2e-108 PFAM
Meta Mutation Damage Score 0.0857 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 96.7%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 A T 7: 120,527,053 D1144V probably damaging Het
Anxa3 A T 5: 96,811,113 I27F probably damaging Het
Aplf T C 6: 87,663,799 E76G possibly damaging Het
Bbs1 A G 19: 4,906,590 probably benign Het
Camk2a T C 18: 60,969,020 S332P probably benign Het
Casz1 T A 4: 148,943,206 F1013L probably damaging Het
Cd109 A T 9: 78,680,810 I707F possibly damaging Het
Cd4 G A 6: 124,872,458 T202I probably benign Het
Celsr1 A G 15: 86,030,782 S997P probably benign Het
Cfap77 T C 2: 29,054,939 T24A probably damaging Het
Dscaml1 G A 9: 45,710,311 R1019H probably damaging Het
Epb41l4b C A 4: 57,063,140 V517F probably benign Het
Exosc10 G A 4: 148,581,134 D818N probably damaging Het
Furin C T 7: 80,393,492 G324S probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ifi206 T C 1: 173,481,207 M408V unknown Het
Kdm4a T C 4: 118,142,555 probably null Het
Neo1 T A 9: 58,902,976 Q1064L probably damaging Het
Nphp4 G A 4: 152,544,406 V750I probably benign Het
Pcdhac1 T C 18: 37,090,236 V34A probably benign Het
Pdk4 T C 6: 5,487,141 I302V probably benign Het
Prl6a1 A G 13: 27,319,048 D209G probably damaging Het
Pspn T C 17: 56,999,515 Q138R probably benign Het
Ptgs2 A G 1: 150,102,078 Y134C probably damaging Het
Rlbp1 G A 7: 79,384,050 probably benign Het
Rpia T C 6: 70,785,548 I108V probably benign Het
Tcaf1 A T 6: 42,675,276 H757Q probably damaging Het
Ttc8 A C 12: 98,943,589 S143R probably damaging Het
Uba6 A G 5: 86,147,073 probably null Het
Ubr4 A T 4: 139,467,230 K4280* probably null Het
Vmn2r15 C A 5: 109,286,372 S822I probably damaging Het
Vps53 A T 11: 76,179,498 M1K probably null Het
Zfp362 A G 4: 128,790,260 M18T possibly damaging Het
Zfp429 A G 13: 67,390,198 C376R probably damaging Het
Zfyve9 T C 4: 108,639,269 N1395S probably damaging Het
Zmynd8 T A 2: 165,807,601 Q857H probably benign Het
Other mutations in Ankrd13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Ankrd13a APN 5 114801802 missense probably damaging 0.99
IGL01303:Ankrd13a APN 5 114786002 missense possibly damaging 0.94
IGL01392:Ankrd13a APN 5 114797853 missense probably benign
IGL01480:Ankrd13a APN 5 114800818 splice site probably benign
IGL01652:Ankrd13a APN 5 114791336 missense probably damaging 1.00
IGL02213:Ankrd13a APN 5 114785968 missense probably damaging 1.00
IGL02512:Ankrd13a APN 5 114786766 missense probably benign 0.16
IGL03268:Ankrd13a APN 5 114792235 missense probably damaging 1.00
R0019:Ankrd13a UTSW 5 114786081 splice site probably benign
R0019:Ankrd13a UTSW 5 114786081 splice site probably benign
R0465:Ankrd13a UTSW 5 114804234 missense probably damaging 0.98
R0960:Ankrd13a UTSW 5 114786807 missense probably benign 0.03
R1222:Ankrd13a UTSW 5 114800763 nonsense probably null
R1538:Ankrd13a UTSW 5 114804234 missense possibly damaging 0.87
R1667:Ankrd13a UTSW 5 114786733 missense possibly damaging 0.89
R1771:Ankrd13a UTSW 5 114803588 missense probably benign 0.08
R2015:Ankrd13a UTSW 5 114792109 missense probably damaging 1.00
R4547:Ankrd13a UTSW 5 114775296 missense probably benign 0.01
R4569:Ankrd13a UTSW 5 114789312 missense probably damaging 1.00
R5401:Ankrd13a UTSW 5 114792173 missense probably damaging 1.00
R5635:Ankrd13a UTSW 5 114801717 missense possibly damaging 0.95
R6238:Ankrd13a UTSW 5 114786726 missense probably benign 0.00
R6562:Ankrd13a UTSW 5 114804392 unclassified probably benign
R6623:Ankrd13a UTSW 5 114786757 missense probably benign 0.28
R7146:Ankrd13a UTSW 5 114775232 missense probably damaging 1.00
R7440:Ankrd13a UTSW 5 114803575 missense possibly damaging 0.65
R7567:Ankrd13a UTSW 5 114789484 intron probably null
R7849:Ankrd13a UTSW 5 114791282 missense possibly damaging 0.89
R7932:Ankrd13a UTSW 5 114791282 missense possibly damaging 0.89
R8006:Ankrd13a UTSW 5 114804423 makesense probably null
Predicted Primers PCR Primer
(F):5'- GGAGGGGCTTTGCATAAGTAATAC -3'
(R):5'- AGCTTTGTGAAATGACCAACAC -3'

Sequencing Primer
(F):5'- GAATTATGAGTTTGAGCCAGCC -3'
(R):5'- CAGAACATTTCCCCAGGAGGTG -3'
Posted On2018-08-29